Human VASN(Vasorin) ELISA Kit

Human VASN(Vasorin) ELISA Kit

To Order Contact us:

Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-48Tests 48 Tests
EUR 544
Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-96Tests 96 Tests
EUR 756
Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-48Tests 48 Tests
EUR 521
Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-96Tests 96 Tests
EUR 723
Mouse Vasorin (VASN) ELISA Kit
EUR 527
  • Should the Mouse Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Vasorin (VASN) in samples from tissue homogenates or other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
EUR 688
  • Should the Mouse Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Vasorin (VASN) in samples from tissue homogenates or other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-48Tests 48 Tests
EUR 557
Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-96Tests 96 Tests
EUR 774
Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-48Tests 48 Tests
EUR 533
Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-96Tests 96 Tests
EUR 740
Human Vasorin (VASN) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human VASN/ Vasorin ELISA Kit
E2651Hu 1 Kit
EUR 571
Human Vasorin, VASN ELISA KIT
ELI-05447h 96 Tests
EUR 824
Human Vasorin (VASN) ELISA Kit
abx572543-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Vasorin ELISA Kit (VASN)
RK02486 96 Tests
EUR 521
Human Vasorin (VASN) ELISA Kit
SEG905Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.
Human Vasorin (VASN) ELISA Kit
SEG905Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.
Human Vasorin (VASN) ELISA Kit
SEG905Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.
Human Vasorin (VASN) ELISA Kit
SEG905Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.
Human Vasorin (VASN) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
  • Slit-Like 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Vasorin (VASN) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Vasorin (VASN) ELISA Kit
abx255015-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Mouse Vasn/ Vasorin ELISA Kit
E1569Mo 1 Kit
EUR 571
Mouse Vasorin, Vasn ELISA KIT
ELI-05448m 96 Tests
EUR 865
Mouse Vasorin (VASN) ELISA Kit
abx571795-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Vasn(Vasorin) ELISA Kit
EM0665 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CZT5
  • Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
Mouse Vasorin (VASN) ELISA Kit
SEG905Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
SEG905Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
SEG905Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
SEG905Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.
Mouse Vasorin (VASN) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
  • Slit-Like 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Vasorin (VASN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Vasorin (VASN) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasorin (VASN) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Vasorin (VASN) Antibody
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Vasorin (VASN) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Vasorin (VASN) Antibody
abx029986-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Vasorin (VASN) Antibody
abx029986-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Recombinant Vasorin (VASN)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6EMK4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Vasorin expressed in: E.coli
Recombinant Vasorin (VASN)
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CZT5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Vasorin expressed in: E.coli
ELISA kit for Human VASN (Vasorin)
ELK3543 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Vasorin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Vasorin (VASN)
KTE60072-48T 48T
EUR 332
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Vasorin (VASN)
KTE60072-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Vasorin (VASN)
KTE60072-96T 96T
EUR 539
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Vasorin (VASN) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Vasorin (VASN) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Mouse VASN (Vasorin)
ELK7122 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Vasorin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Vasorin (VASN)
KTE70030-48T 48T
EUR 332
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Vasorin (VASN)
KTE70030-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Vasorin (VASN)
KTE70030-96T 96T
EUR 539
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Vasorin (VASN) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Vasn ELISA Kit| Mouse Vasorin ELISA Kit
EF013280 96 Tests
EUR 689
Mouse Vasorin (VASN) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human CellExp? Vasorin / VASN, Human recombinant
EUR 142
Human CellExp? Vasorin / VASN, Human recombinant
EUR 479
Vasorin (VASN) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN)
Vasorin (VASN) Polyclonal Antibody (Human, Mouse)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN)
Recombinant Human Vasorin/SLITL2/VASN (C-6His)
C394-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.
Recombinant Human Vasorin/SLITL2/VASN (C-6His)
C394-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.
Recombinant Human Vasorin/SLITL2/VASN (C-6His)
C394-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.
Recombinant Human Vasorin/SLITL2/VASN (C-6His)
C394-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE.
Vasorin (VASN) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC.
Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin.
Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.
Vasorin (VASN) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC.
Vasorin (VASN) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP.
Vasorin (VASN) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE.
Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.
Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.
ELISA kit for Human Vasorin
EK3851 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids.
VASN ELISA Kit (Human) (OKAN05668)
OKAN05668 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL
VASN ELISA Kit (Human) (OKCD09000)
OKCD09000 96 Wells
EUR 975
Description: Description of target: VASN may act as an inhibitor of TGF-beta signaling.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL
VASN ELISA Kit (Human) (OKEH03392)
OKEH03392 96 Wells
EUR 662
Description: Description of target: May act as an inhibitor of TGF-beta signaling.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.177 ng/mL
ELISA kit for Mouse Vasorin
EK3852 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids.
VASN ELISA Kit (Mouse) (OKCD09001)
OKCD09001 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL
VASN ELISA Kit (Mouse) (OKEH01201)
OKEH01201 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
Recombinant human VASN
P1430 100ug Ask for price
  • Uniprot ID: Q6EMK4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VASN
Recombinant Human Vasorin Protein
RP01087 10 μg
EUR 190
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
VASN Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human VASN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VASN Recombinant Protein (Human)
RP034255 100 ug Ask for price
VASN Polyclonal Antibody
29780-100ul 100ul
EUR 252
VASN Polyclonal Antibody
29780-50ul 50ul
EUR 187
VASN Rabbit pAb
A16215-100ul 100 ul
EUR 308
VASN Rabbit pAb
A16215-200ul 200 ul
EUR 459
VASN Rabbit pAb
A16215-20ul 20 ul
EUR 183
VASN Rabbit pAb
A16215-50ul 50 ul
EUR 223
VASN cloning plasmid
CSB-CL025796HU-10ug 10ug
EUR 675
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg
  • Show more
Description: A cloning plasmid for the VASN gene.
VASN Polyclonal Antibody
ABP60871-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
ABP60871-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
ABP60871-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein
VASN Polyclonal Antibody
ES10988-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
VASN Polyclonal Antibody
ES10988-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-VASN antibody
STJ118668 100 µl
EUR 277
Anti-VASN antibody
STJ192146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VASN
VASN ORF Vector (Human) (pORF)
ORF011419 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
VASN Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
VASN Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
VASN Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
VASN Polyclonal Conjugated Antibody
C29780 100ul
EUR 397
Mouse VASN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
VASN Recombinant Protein (Rat)
RP236282 100 ug Ask for price
VASN Recombinant Protein (Mouse)
RP183656 100 ug Ask for price
VASN sgRNA CRISPR Lentivector set (Human)
K2605901 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9
Vasn ORF Vector (Mouse) (pORF)
ORF061220 1.0 ug DNA
EUR 506
Vasn ORF Vector (Rat) (pORF)
ORF078762 1.0 ug DNA
EUR 506
VASN sgRNA CRISPR Lentivector (Human) (Target 1)
K2605902 1.0 ug DNA
EUR 154
VASN sgRNA CRISPR Lentivector (Human) (Target 2)
K2605903 1.0 ug DNA
EUR 154
VASN sgRNA CRISPR Lentivector (Human) (Target 3)
K2605904 1.0 ug DNA
EUR 154
VASN Protein Vector (Human) (pPB-C-His)
PV045673 500 ng
EUR 329
VASN Protein Vector (Human) (pPB-N-His)
PV045674 500 ng
EUR 329
VASN Protein Vector (Human) (pPM-C-HA)
PV045675 500 ng
EUR 329
VASN Protein Vector (Human) (pPM-C-His)
PV045676 500 ng
EUR 329
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Vasn sgRNA CRISPR Lentivector set (Rat)
K6021801 3 x 1.0 ug
EUR 339
Vasn sgRNA CRISPR Lentivector set (Mouse)
K4394901 3 x 1.0 ug
EUR 339
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
Vasn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6021802 1.0 ug DNA
EUR 154
Vasn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6021803 1.0 ug DNA
EUR 154
Vasn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6021804 1.0 ug DNA
EUR 154
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4394902 1.0 ug DNA
EUR 154
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4394903 1.0 ug DNA
EUR 154
Vasn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4394904 1.0 ug DNA
EUR 154
VASN Protein Vector (Mouse) (pPB-C-His)
PV244878 500 ng
EUR 1065
VASN Protein Vector (Mouse) (pPB-N-His)
PV244879 500 ng
EUR 1065
VASN Protein Vector (Mouse) (pPM-C-HA)
PV244880 500 ng
EUR 1065
VASN Protein Vector (Mouse) (pPM-C-His)
PV244881 500 ng
EUR 1065
VASN Protein Vector (Rat) (pPB-C-His)
PV315046 500 ng
EUR 1166
VASN Protein Vector (Rat) (pPB-N-His)
PV315047 500 ng
EUR 1166
VASN Protein Vector (Rat) (pPM-C-HA)
PV315048 500 ng
EUR 1166
VASN Protein Vector (Rat) (pPM-C-His)
PV315049 500 ng
EUR 1166
Vasn 3'UTR Luciferase Stable Cell Line
TU121732 1.0 ml Ask for price
VASN 3'UTR GFP Stable Cell Line
TU078056 1.0 ml
EUR 1394
Vasn 3'UTR GFP Stable Cell Line
TU171732 1.0 ml Ask for price
Vasn 3'UTR Luciferase Stable Cell Line
TU223006 1.0 ml Ask for price
VASN 3'UTR Luciferase Stable Cell Line
TU028056 1.0 ml
EUR 1394
Vasn 3'UTR GFP Stable Cell Line
TU273006 1.0 ml Ask for price
VASN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2605905 3 x 1.0 ug
EUR 376
VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV647353 1.0 ug DNA
EUR 1355
VASN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV647357 1.0 ug DNA
EUR 1355
VASN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV647358 1.0 ug DNA
EUR 1355
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2605906 1.0 ug DNA
EUR 167
VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2605907 1.0 ug DNA
EUR 167
VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2605908 1.0 ug DNA
EUR 167
Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6021805 3 x 1.0 ug
EUR 376
Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4394905 3 x 1.0 ug
EUR 376
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV647354 1.0 ug DNA
EUR 1355
VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV647355 1.0 ug DNA
EUR 1413
VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV647356 1.0 ug DNA
EUR 1413