Human PZP(Pregnancy Zone Protein) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Pregnancy Zone Protein (PZP) ELISA Kit |
RDR-PZP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Pregnancy zone protein (PZP) |
1-CSB-YP019131HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 65.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in Yeast |
Human Pregnancy zone protein (PZP) |
1-CSB-EP019131HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 42.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in E.coli |
Human Pregnancy zone protein (PZP) ELISA Kit |
abx576051-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human PZP/ Pregnancy zone protein ELISA Kit |
E2110Hu |
Sunlong |
1 Kit |
EUR 571 |
Human PZP(Pregnancy zone protein) ELISA Kit |
EH1299 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P20742
- Alias: PZP/CPAMD6(Pregnancy zone protein)/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6/pregnancy-zone protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Human Pregnancy zone protein, PZP ELISA KIT |
ELI-03752h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
20-abx152906 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Pregnancy zone protein(PZP) ELISA kit |
CSB-EL019131HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein (PZP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Pregnancy zone protein(PZP) ELISA kit |
1-CSB-EL019131HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein(PZP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Pregnancy Zone Protein ELISA Kit (PZP) |
RK02175 |
Abclonal |
96 Tests |
EUR 521 |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Pregnancy Zone Protein (PZP) ELISA Kit |
4-SEG324Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
- C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Pregnancy Zone Protein (PZP) Antibody |
20-abx129879 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody |
20-abx002369 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Pregnancy Zone Protein (PZP) Antibody |
20-abx102180 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody |
20-abx102181 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody |
20-abx102182 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody |
20-abx174149 |
Abbexa |
|
|
|
Recombinant Pregnancy Zone Protein (PZP) |
4-RPG324Hu01 |
Cloud-Clone |
-
EUR 583.84
-
EUR 259.00
-
EUR 1914.40
-
EUR 704.80
-
EUR 1309.60
-
EUR 454.00
-
EUR 4636.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20742
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.1kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Human Pregnancy Zone Protein expressed in: E.coli |
Recombinant Pregnancy Zone Protein (PZP) |
4-RPG324Mu01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q61838
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli |
Recombinant Pregnancy Zone Protein (PZP) |
4-RPG324Mu02 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q61838
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli |
Recombinant Pregnancy Zone Protein (PZP) |
4-RPG324Ra01 |
Cloud-Clone |
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
-
EUR 660.00
-
EUR 1220.00
-
EUR 430.00
-
EUR 4300.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q63041
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 53.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Pregnancy Zone Protein expressed in: E.coli |
Human Pregnancy Zone Protein (PZP) Protein |
20-abx068659 |
Abbexa |
-
EUR 815.00
-
EUR 314.00
-
EUR 2569.00
-
EUR 968.00
-
EUR 565.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
20-abx258971 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
20-abx258972 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Pregnancy Zone Protein ELISA Kit (PZP) |
RK03150 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Pregnancy Zone Protein (PZP) ELISA Kit |
4-SEG324Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
- C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
SEG324Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Pregnancy Zone Protein (PZP) ELISA Kit |
4-SEG324Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6
- C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Pregnancy Zone Protein (PZP) CLIA Kit |
20-abx495159 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PZP (Pregnancy Zone Protein) |
ELK3309 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn
- Show more
|
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Pregnancy zone protein (PZP) |
KTE61009-48T |
Abbkine |
48T |
EUR 332 |
- Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Pregnancy zone protein (PZP) |
KTE61009-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Pregnancy zone protein (PZP) |
KTE61009-96T |
Abbkine |
96T |
EUR 539 |
- Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Pregnancy Zone Protein (PZP) Protein |
20-abx068660 |
Abbexa |
-
EUR 759.00
-
EUR 300.00
-
EUR 2388.00
-
EUR 913.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Pregnancy Zone Protein (PZP) Protein |
20-abx068661 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Mouse Pregnancy Zone Protein (PZP) Protein |
20-abx165942 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody (HRP) |
20-abx274625 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1525.00
-
EUR 704.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pregnancy Zone Protein (PZP) Antibody Pair |
20-abx370759 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody Pair |
20-abx370771 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody (FITC) |
20-abx271207 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1525.00
-
EUR 704.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody (FITC) |
20-abx271260 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody (Biotin) |
20-abx271473 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody (Biotin) |
20-abx271526 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pregnancy Zone Protein (PZP) Antibody (Biotin) |
20-abx272390 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Pregnancy Zone Protein (PZP) CLIA Kit |
20-abx496457 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Pregnancy Zone Protein (PZP) CLIA Kit |
20-abx496528 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Mouse PZP (Pregnancy Zone Protein) |
ELK7696 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn
- Show more
|
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat PZP (Pregnancy Zone Protein) |
ELK7710 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn
- Show more
|
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human) |
4-PAG324Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP) |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse) |
4-PAG324Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP) |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse) |
4-PAG324Mu02 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP) |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat) |
4-PAG324Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP) |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC |
4-PAG324Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Biotinylated |
4-PAG324Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Cy3 |
4-PAG324Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), FITC |
4-PAG324Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with FITC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), HRP |
4-PAG324Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with HRP. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), PE |
4-PAG324Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with PE. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC |
4-PAG324Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAG324Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3 |
4-PAG324Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC |
4-PAG324Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP |
4-PAG324Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE |
4-PAG324Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC |
4-PAG324Mu02-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAG324Mu02-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3 |
4-PAG324Mu02-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC |
4-PAG324Mu02-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP |
4-PAG324Mu02-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE |
4-PAG324Mu02-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC |
4-PAG324Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Biotinylated |
4-PAG324Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Cy3 |
4-PAG324Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), FITC |
4-PAG324Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with FITC. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), HRP |
4-PAG324Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with HRP. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), PE |
4-PAG324Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with PE. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC-Cy7 |
4-PAG324Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Val1212~Met1391)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAG324Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Tyr1224~Ala1495)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAG324Mu02-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1246~Ala1495)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7. |
Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAG324Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PZP (Leu1251~Ala1500)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7. |
Pregnancy-Zone Protein Antibody |
20-abx114669 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
pregnancy zone protein Antibody |
abx236763-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Pregnancy zone Antibody |
20-abx110113 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
anti- pregnancy zone protein antibody |
FNab06763 |
FN Test |
100µg |
EUR 585 |
- Immunogen: pregnancy-zone protein
- Uniprot ID: P20742
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against pregnancy zone protein |
Pregnancy zone Antibody (HRP) |
20-abx108629 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pregnancy zone Antibody (Biotin) |
20-abx105791 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pregnancy zone Antibody (FITC) |
20-abx107209 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Human Pregnancy zone protein Protein, His, E.coli-100ug |
QP6563-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Pregnancy zone protein Protein, His, E.coli-10ug |
QP6563-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Pregnancy zone protein Protein, His, E.coli-1mg |
QP6563-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Pregnancy zone protein Protein, His, E.coli-200ug |
QP6563-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Pregnancy zone protein Protein, His, E.coli-500ug |
QP6563-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Pregnancy zone protein Protein, His, E.coli-50ug |
QP6563-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-100ug |
QP6563-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-10ug |
QP6563-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-1mg |
QP6563-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-200ug |
QP6563-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-500ug |
QP6563-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human Pregnancy zone protein Protein, GST, Yeast-50ug |
QP6563-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
Human PZP PicoKine ELISA Kit |
EK1873 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA). |
PZP ELISA Kit (Human) (OKAN06584) |
OKAN06584 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL |
PZP ELISA Kit (Human) (OKCD08911) |
OKCD08911 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Rabbit anti-human Pregnancy zone polyclonal Antibody;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL |
PZP ELISA Kit (Human) (OKBB01285) |
OKBB01285 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Pregnancy zone protein (PZP) is a protein which in humans is encoded by the PZP gene on chromosome 12. It is mapped to 12p13.31. The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
PZP ELISA Kit (Human) (OKEH04635) |
OKEH04635 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 43 pg/mL |
PZP ELISA Kit (Mouse) (OKAN04986) |
OKAN04986 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL |
PZP ELISA Kit (Mouse) (OKCD08912) |
OKCD08912 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region, a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.64ng/mL |
PZP ELISA Kit (Rat) (OKCD08913) |
OKCD08913 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: plasma protease inhibitor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.7ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Epidermal basement membrane zone ELISA kit |
E01E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epidermal basement membrane zone ELISA kit |
E01E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epidermal basement membrane zone ELISA kit |
E01E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epidermal basement membrane zone ELISA kit |
E01E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epidermal basement membrane zone ELISA kit |
E01E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Epidermal basement membrane zone ELISA kit |
E01E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Associated Glycoproteins ELISA kit |
E01P0612-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Associated Glycoproteins ELISA kit |
E01P0612-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Associated Glycoproteins ELISA kit |
E01P0612-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PZP antibody |
70R-19675 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PZP antibody |
PZP Antibody |
1-CSB-PA019131GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PZP Antibody |
1-CSB-PA019131HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
Human Pregnancy associated plasma protein A ELISA kit |
E01P0611-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy associated plasma protein A ELISA kit |
E01P0611-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy associated plasma protein A ELISA kit |
E01P0611-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Specific Protein B(PSPB) ELISA kit |
E01P0932-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Specific Protein B(PSPB) ELISA kit |
E01P0932-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Pregnancy Specific Protein B(PSPB) ELISA kit |
E01P0932-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human epidermal basement membrane zone(EBMZ)ELISA Kit |
GA-E0477HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human epidermal basement membrane zone(EBMZ)ELISA Kit |
GA-E0477HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human epidermal basement membrane zone,EBMZ ELISA Kit |
201-12-0461 |
SunredBio |
96 tests |
EUR 440 |
- This epidermal basement membrane zone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human epidermal basement membrane zone,EBMZ ELISA Kit |
CN-03769H1 |
ChemNorm |
96T |
EUR 486 |
Human epidermal basement membrane zone,EBMZ ELISA Kit |
CN-03769H2 |
ChemNorm |
48T |
EUR 333 |
Human epidermal basement membrane zone, EBMZ ELISA Kit |
CSB-E09524h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human epidermal basement membrane zone, EBMZ in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human epidermal basement membrane zone, EBMZ ELISA Kit |
1-CSB-E09524h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human epidermal basement membrane zone, EBMZ in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human epidermal basement membrane zone(EBMZ)ELISA Kit |
QY-E02670 |
Qayee Biotechnology |
96T |
EUR 361 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
20-abx152636 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
abx252733-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
DLR-PAPPA-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
DLR-PAPPA-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
ELISA kit for Human Pregnancy Specific Protein B (PSPB) |
KTE61088-48T |
Abbkine |
48T |
EUR 354 |
- Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Pregnancy Specific Protein B (PSPB) |
KTE61088-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Pregnancy Specific Protein B (PSPB) |
KTE61088-96T |
Abbkine |
96T |
EUR 572 |
- Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
SEA800Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
SEA800Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
SEA800Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
SEA800Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
4-SEA800Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Pregnancy Associated Plasma Protein A elisa. Alternative names of the recognized antigen: PAPP-A
- PAPA
- ASBABP2
- DIPLA1
- IGFBP-4ase
- PAPPA1
- Pappalysin 1
- Insulin-Like Growth Factor Binding Protein-4 Protease
- Differentially Placenta 1
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Pregnancy Associated Plasma Protein A ELISA Kit (PAPPA) |
RK02017 |
Abclonal |
96 Tests |
EUR 521 |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
RD-PAPPA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
RD-PAPPA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
RDR-PAPPA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit |
RDR-PAPPA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Goat Epidermal basement membrane zone ELISA kit |
E06E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Epidermal basement membrane zone ELISA kit |
E06E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Epidermal basement membrane zone ELISA kit |
E06E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Epidermal basement membrane zone ELISA kit |
E06E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Epidermal basement membrane zone ELISA kit |
E06E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Epidermal basement membrane zone ELISA kit |
E06E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Epidermal basement membrane zone ELISA kit |
E02E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Epidermal basement membrane zone ELISA kit |
E03E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Epidermal basement membrane zone ELISA kit |
E04E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Epidermal basement membrane zone ELISA kit |
E08E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Epidermal basement membrane zone ELISA kit |
E09E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0121-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0121-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0121-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0123-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0123-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Epidermal basement membrane zone ELISA kit |
E07E0123-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PZP cloning plasmid |
CSB-CL019131HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3807
- Sequence: ATGTCTGAATCTTATCGGAGAACTACTTTTCCAGTAAGATTCCGTGTTGTCTCCGTGGATGAAAATTTTCGCCCTCGAAATGAACTGATTCCACTGATATACCTTGAGAACCCAAGAAGAAATCGAATTGCACAATGGCAGAGTCTCAAGCTAGAAGCTGGCATCAATCAGTTGT
- Show more
|
Description: A cloning plasmid for the PZP gene. |
PZP Polyclonal Antibody |
ES11393-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PZP Polyclonal Antibody |
ES11393-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PZP Polyclonal Antibody |
ABP60051-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
- Applications tips:
|
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 |
PZP Polyclonal Antibody |
ABP60051-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
- Applications tips:
|
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 |
PZP Polyclonal Antibody |
ABP60051-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350
- Applications tips:
|
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 |
PZP Polyclonal Antibody |
A53244 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PZP Rabbit pAb |
A3324-100ul |
Abclonal |
100 ul |
EUR 308 |
PZP Rabbit pAb |
A3324-200ul |
Abclonal |
200 ul |
EUR 459 |
PZP Rabbit pAb |
A3324-20ul |
Abclonal |
20 ul |
EUR 183 |
PZP Rabbit pAb |
A3324-50ul |
Abclonal |
50 ul |
EUR 223 |
PZP Polyclonal Antibody |
30444-100ul |
SAB |
100ul |
EUR 252 |
PZP Polyclonal Antibody |
30444-50ul |
SAB |
50ul |
EUR 187 |
Anti-PZP antibody |
STJ116200 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients. |
Anti-PZP antibody |
STJ192551 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PZP |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
PSPB ELISA Kit| Bovine Pregnancy Specific Protein B ELISA Kit |
EF010970 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat Pregnancy Associated Glycoproteins ELISA kit |
E02P0612-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Pregnancy Associated Glycoproteins ELISA kit |
E02P0612-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Pregnancy Associated Glycoproteins ELISA kit |
E02P0612-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Pregnancy Associated Glycoproteins ELISA kit |
E03P0612-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Pregnancy Associated Glycoproteins ELISA kit |
E03P0612-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE
|