Human PZP(Pregnancy Zone Protein) ELISA Kit

Human PZP(Pregnancy Zone Protein) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Pregnancy Zone Protein (PZP) ELISA Kit
RD-PZP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Pregnancy zone protein (PZP)
1-CSB-EP019131HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 42.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in E.coli

Human Pregnancy zone protein (PZP)
1-CSB-YP019131HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 65.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pregnancy zone protein(PZP),partial expressed in Yeast

Human Pregnancy zone protein(PZP) ELISA kit
CSB-EL019131HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein (PZP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Pregnancy zone protein(PZP) ELISA kit
1-CSB-EL019131HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Human Pregnancy zone protein(PZP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Pregnancy Zone Protein (PZP) ELISA Kit
20-abx152906	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human PZP/ Pregnancy zone protein ELISA Kit
E2110Hu	Sunlong	1 Kit	EUR 571

Human PZP(Pregnancy zone protein) ELISA Kit
EH1299	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P20742 Alias: PZP/CPAMD6(Pregnancy zone protein)/C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6/pregnancy-zone protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Pregnancy zone protein, PZP ELISA KIT
ELI-03752h	Lifescience Market	96 Tests	EUR 824

Human Pregnancy zone protein (PZP) ELISA Kit
abx576051-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Pregnancy Zone Protein(PZP)ELISA Kit
QY-E01765	Qayee Biotechnology	96T	EUR 361

Human Pregnancy Zone Protein ELISA Kit (PZP)
RK02175	Abclonal	96 Tests	EUR 521

Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Human Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6 C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Pregnancy Zone Protein (PZP) Antibody
20-abx102180	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx102181	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx102182	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx129879	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody
20-abx174149	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Pregnancy Zone Protein (PZP) Antibody
20-abx002369	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Hu01	Cloud-Clone	EUR 583.84 EUR 259.00 EUR 1914.40 EUR 704.80 EUR 1309.60 EUR 454.00 EUR 4636.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20742 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.1kDa Isoelectric Point: 6.3
Description: Recombinant Human Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61838 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Mu02	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61838 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pregnancy Zone Protein expressed in: E.coli

Recombinant Pregnancy Zone Protein (PZP)
4-RPG324Ra01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q63041 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Pregnancy Zone Protein expressed in: E.coli

Human Pregnancy Zone Protein (PZP) Protein
20-abx068659	Abbexa	EUR 815.00 EUR 314.00 EUR 2569.00 EUR 968.00 EUR 565.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258971	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
20-abx258972	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Pregnancy Zone Protein ELISA Kit (PZP)
RK03150	Abclonal	96 Tests	EUR 521

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6 C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
SEG324Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Pregnancy Zone Protein (PZP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Pregnancy Zone Protein (PZP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Pregnancy Zone Protein (PZP) ELISA Kit
4-SEG324Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Pregnancy Zone Protein elisa. Alternative names of the recognized antigen: CPAMD6 C3 and PZP-like alpha-2-macroglobulin domain-containing protein 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Pregnancy Zone Protein (PZP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Pregnancy Zone Protein (PZP) CLIA Kit
20-abx495159	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PZP (Pregnancy Zone Protein)
ELK3309	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn Show more
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Pregnancy zone protein (PZP)
KTE61009-48T	Abbkine	48T	EUR 332
Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pregnancy zone protein (PZP)
KTE61009-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pregnancy zone protein (PZP)
KTE61009-96T	Abbkine	96T	EUR 539
Pregnancy zone protein (PZP), one of the major pregnancy-associated plasma proteins, was described by Smithies (1959) who used zone-electrophoresis in starch gels. PZP is a prominent constituent of late-pregnancy sera. In healthy, nonpregnant females Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy zone protein (PZP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Pregnancy Zone Protein (PZP) Protein
20-abx165942	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Pregnancy Zone Protein (PZP) Protein
20-abx068660	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Pregnancy Zone Protein (PZP) Protein
20-abx068661	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271207	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (FITC)
20-abx271260	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271473	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx271526	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (Biotin)
20-abx272390	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370759	Abbexa	EUR 1859.00 EUR 1177.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody Pair
20-abx370771	Abbexa	EUR 1776.00 EUR 1135.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Pregnancy Zone Protein (PZP) Antibody (HRP)
20-abx274625	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496457	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Pregnancy Zone Protein (PZP) CLIA Kit
20-abx496528	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse PZP (Pregnancy Zone Protein)
ELK7696	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn Show more
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat PZP (Pregnancy Zone Protein)
ELK7710	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pregnancy Zone Protein (PZP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pregn Show more
Description: A sandwich ELISA kit for detection of Pregnancy Zone Protein from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human)
4-PAG324Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse)
4-PAG324Mu02	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat)
4-PAG324Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP)

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC
4-PAG324Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Biotinylated
4-PAG324Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), Cy3
4-PAG324Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), FITC
4-PAG324Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), HRP
4-PAG324Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), PE
4-PAG324Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC
4-PAG324Mu02-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Biotinylated
4-PAG324Mu02-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), Cy3
4-PAG324Mu02-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), FITC
4-PAG324Mu02-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), HRP
4-PAG324Mu02-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), PE
4-PAG324Mu02-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC
4-PAG324Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Biotinylated
4-PAG324Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Biotin.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), Cy3
4-PAG324Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with Cy3.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), FITC
4-PAG324Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with FITC.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), HRP
4-PAG324Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with HRP.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), PE
4-PAG324Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with PE.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Human), APC-Cy7
4-PAG324Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Val1212~Met1391) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Tyr1224~Ala1495) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG324Mu02-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1246~Ala1495) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy Zone Protein (PZP) Polyclonal Antibody (Rat), APC-Cy7
4-PAG324Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PZP (Leu1251~Ala1500) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Pregnancy Zone Protein (PZP). This antibody is labeled with APC-Cy7.

Pregnancy-Zone Protein Antibody
20-abx114669	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

pregnancy zone protein Antibody
abx236763-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Pregnancy zone Antibody
20-abx110113	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti- pregnancy zone protein antibody
FNab06763	FN Test	100µg	EUR 585
Immunogen: pregnancy-zone protein Uniprot ID: P20742 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against pregnancy zone protein

Anti-pregnancy zone protein antibody
PAab06763	Lifescience Market	100 ug	EUR 412

Pregnancy zone Antibody (Biotin)
20-abx105791	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pregnancy zone Antibody (FITC)
20-abx107209	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pregnancy zone Antibody (HRP)
20-abx108629	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Human Pregnancy zone protein Protein, His, E.coli-100ug
QP6563-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Pregnancy zone protein Protein, His, E.coli-10ug
QP6563-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Pregnancy zone protein Protein, His, E.coli-1mg
QP6563-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Pregnancy zone protein Protein, His, E.coli-200ug
QP6563-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Pregnancy zone protein Protein, His, E.coli-500ug
QP6563-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Pregnancy zone protein Protein, His, E.coli-50ug
QP6563-ec-50ug	EnQuireBio	50ug	EUR 263

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-100ug
QP6563-ye-100ug	EnQuireBio	100ug	EUR 480

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-10ug
QP6563-ye-10ug	EnQuireBio	10ug	EUR 236

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-1mg
QP6563-ye-1mg	EnQuireBio	1mg	EUR 1885

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-200ug
QP6563-ye-200ug	EnQuireBio	200ug	EUR 744

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-500ug
QP6563-ye-500ug	EnQuireBio	500ug	EUR 1206

Recombinant Human Pregnancy zone protein Protein, GST, Yeast-50ug
QP6563-ye-50ug	EnQuireBio	50ug	EUR 299

Human PZP ELISA Kit
ELA-E1140h	Lifescience Market	96 Tests	EUR 824

PZP ELISA KIT\|Human
EF003623	Lifescience Market	96 Tests	EUR 689

Human PZP PicoKine ELISA Kit
EK1873	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human PZP in cell culture supernates, serum and plasma (heparin, EDTA).

PZP ELISA Kit (Human) (OKAN06584)
OKAN06584	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL

PZP ELISA Kit (Human) (OKBB01285)
OKBB01285	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Pregnancy zone protein (PZP) is a protein which in humans is encoded by the PZP gene on chromosome 12. It is mapped to 12p13.31. The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

PZP ELISA Kit (Human) (OKCD08911)
OKCD08911	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Rabbit anti-human Pregnancy zone polyclonal Antibody;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL

PZP ELISA Kit (Human) (OKEH04635)
OKEH04635	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 43 pg/mL

PZP ELISA Kit (Mouse) (OKAN04986)
OKAN04986	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.65 ng/mL

PZP ELISA Kit (Mouse) (OKCD08912)
OKCD08912	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Is able to inhibit all four classes of proteinases by a unique 'trapping' mechanism. This protein has a peptide stretch, called the 'bait region' which contains specific cleavage sites for different proteinases. When a proteinase cleaves the bait region, a conformational change is induced in the protein which traps the proteinase. The entrapped enzyme remains active against low molecular weight substrates (activity against high molecular weight substrates is greatly reduced). Following cleavage in the bait region, a thioester bond is hydrolyzed and mediates the covalent binding of the protein to the proteinase. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.64ng/mL

PZP ELISA Kit (Rat) (OKCD08913)
OKCD08913	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: plasma protease inhibitor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.7ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Epidermal basement membrane zone ELISA kit
E01E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epidermal basement membrane zone ELISA kit
E01E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epidermal basement membrane zone ELISA kit
E01E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epidermal basement membrane zone ELISA kit
E01E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epidermal basement membrane zone ELISA kit
E01E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epidermal basement membrane zone ELISA kit
E01E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Associated Glycoproteins ELISA kit
E01P0612-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Associated Glycoproteins ELISA kit
E01P0612-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Associated Glycoproteins ELISA kit
E01P0612-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PZP antibody
70R-19675	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PZP antibody

PZP Antibody
1-CSB-PA019131GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PZP Antibody
1-CSB-PA019131HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PZP. Recognizes PZP from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Human Pregnancy associated plasma protein A ELISA kit
E01P0611-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy associated plasma protein A ELISA kit
E01P0611-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy associated plasma protein A ELISA kit
E01P0611-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy associated plasma protein A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Specific Protein B(PSPBï¼‰ ELISA kit
E01P0932-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPBï¼‰ in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Specific Protein B(PSPBï¼‰ ELISA kit
E01P0932-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPBï¼‰ in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Pregnancy Specific Protein B(PSPBï¼‰ ELISA kit
E01P0932-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Pregnancy Specific Protein B(PSPBï¼‰ in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human epidermal basement membrane zone,EBMZ ELISA Kit
201-12-0461	SunredBio	96 tests	EUR 440
This epidermal basement membrane zone ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human epidermal basement membrane zone,EBMZ ELISA Kit
CN-03769H1	ChemNorm	96T	EUR 486

Human epidermal basement membrane zone,EBMZ ELISA Kit
CN-03769H2	ChemNorm	48T	EUR 333

Human epidermal basement membrane zone, EBMZ ELISA Kit
CSB-E09524h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human epidermal basement membrane zone, EBMZ in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human epidermal basement membrane zone, EBMZ ELISA Kit
1-CSB-E09524h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human epidermal basement membrane zone, EBMZ in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human epidermal basement membrane zone(EBMZ)ELISA Kit
GA-E0477HM-48T	GenAsia Biotech	48T	EUR 289

Human epidermal basement membrane zone(EBMZ)ELISA Kit
GA-E0477HM-96T	GenAsia Biotech	96T	EUR 466

Human epidermal basement membrane zone(EBMZ)ELISA Kit
QY-E02670	Qayee Biotechnology	96T	EUR 361

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
DLR-PAPPA-Hu-48T	DL Develop	48T	EUR 479
Should the Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
DLR-PAPPA-Hu-96T	DL Develop	96T	EUR 621
Should the Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
20-abx152636	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
abx252733-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

ELISA kit for Human Pregnancy Specific Protein B (PSPB)
KTE61088-48T	Abbkine	48T	EUR 354
Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pregnancy Specific Protein B (PSPB)
KTE61088-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pregnancy Specific Protein B (PSPB)
KTE61088-96T	Abbkine	96T	EUR 572
Pregnancy-specific protein B (PSPB), is secreted from binucleate trophoblast of the bovine conceptus as early as day 15 of pregnancy. This is the first indication that PSPB has a hormonal role in inducing GCP-2, an alpha chemokine that also is induce Show more
Description: Quantitative sandwich ELISA for measuring Human Pregnancy Specific Protein B (PSPB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Pregnancy Associated Plasma Protein A ELISA Kit (PAPPA)
RK02017	Abclonal	96 Tests	EUR 521

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
SEA800Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
SEA800Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
SEA800Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
SEA800Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pregnancy Associated Plasma Protein A (PAPPA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
4-SEA800Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Pregnancy Associated Plasma Protein A elisa. Alternative names of the recognized antigen: PAPP-A PAPA ASBABP2 DIPLA1 IGFBP-4ase PAPPA1 Pappalysin 1 Insulin-Like Growth Factor Binding Protein-4 Protease Differentially Placenta 1 Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pregnancy Associated Plasma Protein A (PAPPA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
RDR-PAPPA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
RDR-PAPPA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
RD-PAPPA-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Pregnancy Associated Plasma Protein A (PAPPA) ELISA Kit
RD-PAPPA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Rat Epidermal basement membrane zone ELISA kit
E02E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Epidermal basement membrane zone ELISA kit
E02E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Epidermal basement membrane zone ELISA kit
E02E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Epidermal basement membrane zone ELISA kit
E02E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Epidermal basement membrane zone ELISA kit
E02E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Epidermal basement membrane zone ELISA kit
E02E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Epidermal basement membrane zone ELISA kit
E06E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Epidermal basement membrane zone ELISA kit
E04E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Epidermal basement membrane zone ELISA kit
E09E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Epidermal basement membrane zone ELISA kit
E08E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Epidermal basement membrane zone ELISA kit
E07E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PZP Polyclonal Antibody
30444-100ul	SAB	100ul	EUR 252

PZP Polyclonal Antibody
30444-50ul	SAB	50ul	EUR 187

PZP cloning plasmid
CSB-CL019131HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 3807 Sequence: ATGTCTGAATCTTATCGGAGAACTACTTTTCCAGTAAGATTCCGTGTTGTCTCCGTGGATGAAAATTTTCGCCCTCGAAATGAACTGATTCCACTGATATACCTTGAGAACCCAAGAAGAAATCGAATTGCACAATGGCAGAGTCTCAAGCTAGAAGCTGGCATCAATCAGTTGT Show more
Description: A cloning plasmid for the PZP gene.

PZP Rabbit pAb
A3324-100ul	Abclonal	100 ul	EUR 308

PZP Rabbit pAb
A3324-200ul	Abclonal	200 ul	EUR 459

PZP Rabbit pAb
A3324-20ul	Abclonal	20 ul	EUR 183

PZP Rabbit pAb
A3324-50ul	Abclonal	50 ul	EUR 223

PZP Polyclonal Antibody
A53244	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PZP Polyclonal Antibody
ABP60051-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350

PZP Polyclonal Antibody
ABP60051-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350

PZP Polyclonal Antibody
ABP60051-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350 Applications tips:
Description: A polyclonal antibody for detection of PZP from Human. This PZP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PZP protein at amino acid sequence of 1301-1350

PZP Polyclonal Antibody
ES11393-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PZP Polyclonal Antibody
ES11393-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PZP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PZP antibody
STJ116200	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients.

Anti-PZP antibody
STJ192551	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PZP

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PSPB ELISA Kit\| Bovine Pregnancy Specific Protein B ELISA Kit
EF010970	Lifescience Market	96 Tests	EUR 689

Rat Pregnancy Associated Glycoproteins ELISA kit
E02P0612-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pregnancy Associated Glycoproteins ELISA kit
E02P0612-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Pregnancy Associated Glycoproteins ELISA kit
E02P0612-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pregnancy Associated Glycoproteins ELISA kit
E04P0612-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Pregnancy Associated Glycoproteins in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Pregnancy Associated Glycoproteins ELISA kit
E04P0612-48	B-Gene	1 plate of 48 wells	EUR 520