Human DTNb(Dystrobrevin Beta) ELISA Kit

Human DTNb(Dystrobrevin Beta) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Dystrobrevin Beta (DTNb) ELISA Kit
RD-DTNb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dystrobrevin beta, DTNB ELISA KIT
ELI-09370h	Lifescience Market	96 Tests	EUR 824

Human Dystrobrevin beta (DTNb) ELISA Kit
20-abx151363	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dystrobrevin Beta(DTNb)ELISA Kit
QY-E00444	Qayee Biotechnology	96T	EUR 374

Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit
SEF385Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit
4-SEF385Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dystrobrevin Beta elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dystrobrevin Beta (DTNb) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Dystrobrevin Beta (DTNB) Antibody
20-abx112211	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Beta (DTNb) Antibody
20-abx130457	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dystrobrevin Beta (DTNB) Antibody
abx122407-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Dystrobrevin Beta (DTNb) Antibody
20-abx172179	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Dystrobrevin Beta (DTNB) Antibody
20-abx339607	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Beta (DTNB) Antibody
20-abx210815	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Beta (DTNB) Antibody
abx232551-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Dystrobrevin Beta (DTNb)
4-RPF385Hu01	Cloud-Clone	EUR 460.19 EUR 226.00 EUR 1450.72 EUR 550.24 EUR 1000.48 EUR 371.00 EUR 3476.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O60941 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Dystrobrevin Beta expressed in: E.coli

Mouse Dystrobrevin beta, Dtnb ELISA KIT
ELI-47723m	Lifescience Market	96 Tests	EUR 865

Human Dystrobrevin Beta (DTNb) Protein
20-abx650657	Abbexa	EUR 648.00 EUR 272.00 EUR 1957.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Dystrobrevin beta (DTNb) CLIA Kit
20-abx494887	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human DTNb (Dystrobrevin Beta)
ELK3317	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dystrobrevin Beta (DTN?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dystrobre Show more
Description: A sandwich ELISA kit for detection of Dystrobrevin Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-48T	Abbkine	48T	EUR 332
Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)
KTE61971-96T	Abbkine	96T	EUR 539
Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human)
4-PAF385Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb)

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC
4-PAF385Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Biotinylated
4-PAF385Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Biotin.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Cy3
4-PAF385Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Cy3.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), FITC
4-PAF385Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with FITC.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), HRP
4-PAF385Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with HRP.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), PE
4-PAF385Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with PE.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC-Cy7
4-PAF385Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNb (Met1~Glu249) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC-Cy7.

Recombinant human Dystrobrevin beta
P2840	FN Test	100ug	Ask for price
Uniprot ID: O60941 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Dystrobrevin beta

anti-Dystrobrevin beta
YF-PA11436	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Dystrobrevin beta

anti-Dystrobrevin beta
YF-PA11437	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dystrobrevin beta

anti-Dystrobrevin beta
YF-PA23608	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Dystrobrevin beta

Dtnb/ Rat Dtnb ELISA Kit
ELI-47526r	Lifescience Market	96 Tests	EUR 886

Anti-Dystrobrevin beta (1D3)
YF-MA12738	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Dystrobrevin beta

DTNB ELISA KIT|Human
EF009230	Lifescience Market	96 Tests	EUR 689

DTNB ELISA Kit (Human) (OKCD00463)
OKCD00463	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

DTNb ELISA Kit (Human) (OKDD00246)
OKDD00246	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

Human Dystrobrevin alpha, DTNA ELISA KIT
ELI-31605h	Lifescience Market	96 Tests	EUR 824

Human Dystrobrevin Alpha (DTNA) ELISA Kit
abx386993-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Dystrobrevin Alpha(DTNa)ELISA Kit
QY-E00445	Qayee Biotechnology	96T	EUR 374

DTNB
HY-15915	MedChemExpress	5g	EUR 147

Mouse Dystrobrevin alpha, Dtna ELISA KIT
ELI-47722m	Lifescience Market	96 Tests	EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DTNB siRNA
20-abx901595	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DTNB siRNA
20-abx914688	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DTNB siRNA
20-abx914689	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DTNB antibody
70R-3432	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DTNB antibody raised against the C terminal of DTNB

DTNB Antibody
36425-100ul	SAB	100ul	EUR 252

DTNB antibody
10R-6896	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody
10R-6897	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody
10R-6898	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody
10R-6899	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody
10R-6900	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody
70R-16945	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DTNB antibody

DTNB Antibody
1-CSB-PA007217GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DTNB Antibody
1-CSB-PA756613	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DTNB Antibody
1-CSB-PA187891	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Human Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx250983-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human DTNB shRNA Plasmid
20-abx951286	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DTNB Recombinant Protein (Human)
RP009880	ABM	100 ug	Ask for price

anti-Dystrobrevin alpha
YF-PA11433	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

anti-Dystrobrevin alpha
YF-PA11434	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

anti-Dystrobrevin alpha
YF-PA11435	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

DTNB Conjugated Antibody
C36425	SAB	100ul	EUR 397

DTNB cloning plasmid
CSB-CL007217HU-10ug	Cusabio	10ug	EUR 581
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1683 Sequence: atgattgaggaaagtgggaacaagcggaagaccatggcagagaagaggcagctgttcatagaaatgcgtgctcagaattttgatgtcatacgactatcaacttacagaacagcctgcaaattacgatttgtacaaaaacgatgcaaccttcatcttgttgatatctggaacatga Show more
Description: A cloning plasmid for the DTNB gene.

anti- DTNB antibody
FNab02551	FN Test	100µg	EUR 548.75
Immunogen: dystrobrevin, beta Uniprot ID: O60941 Gene ID: 1838 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DTNB

DTNB Rabbit pAb
A12866-100ul	Abclonal	100 ul	EUR 308

DTNB Rabbit pAb
A12866-200ul	Abclonal	200 ul	EUR 459

DTNB Rabbit pAb
A12866-20ul	Abclonal	20 ul	EUR 183

DTNB Rabbit pAb
A12866-50ul	Abclonal	50 ul	EUR 223

DTNB Blocking Peptide
33R-1524	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTNB antibody, catalog no. 70R-3432

Anti-DTNB antibody
PAab02551	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-DTNB
PVT12852	Lifescience Market	2 ug	EUR 391

Anti-DTNB antibody
STJ114732	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.

DTNB (Ellman's Reagent)
DB0113	Bio Basic	5g	EUR 97.85
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

DTNB ORF Vector (Human) (pORF)
ORF003294	ABM	1.0 ug DNA	EUR 95

Cow Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517260-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517261-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517263-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit
abx517264-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Dystrobrevin Alpha (DTNA) Antibody
20-abx125789	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody
20-abx112210	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody
abx026894-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody
abx026894-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody
abx232550-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat DTNB shRNA Plasmid
20-abx990429	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DTNB shRNA Plasmid
20-abx970075	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DTNB Recombinant Protein (Rat)
RP198725	ABM	100 ug	Ask for price

DTNB Recombinant Protein (Mouse)
RP130163	ABM	100 ug	Ask for price

DTNB Recombinant Protein (Mouse)
RP130166	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

DTNB sgRNA CRISPR Lentivector set (Human)
K0635701	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Dtnb ORF Vector (Rat) (pORF)
ORF066243	ABM	1.0 ug DNA	EUR 506

Dtnb ORF Vector (Mouse) (pORF)
ORF043389	ABM	1.0 ug DNA	EUR 506

Dtnb ORF Vector (Mouse) (pORF)
ORF043390	ABM	1.0 ug DNA	EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

DTNB sgRNA CRISPR Lentivector (Human) (Target 1)
K0635702	ABM	1.0 ug DNA	EUR 154

DTNB sgRNA CRISPR Lentivector (Human) (Target 2)
K0635703	ABM	1.0 ug DNA	EUR 154

DTNB sgRNA CRISPR Lentivector (Human) (Target 3)
K0635704	ABM	1.0 ug DNA	EUR 154

DTNB Protein Vector (Human) (pPB-C-His)
PV013173	ABM	500 ng	EUR 329

DTNB Protein Vector (Human) (pPB-N-His)
PV013174	ABM	500 ng	EUR 329

DTNB Protein Vector (Human) (pPM-C-HA)
PV013175	ABM	500 ng	EUR 329

DTNB Protein Vector (Human) (pPM-C-His)
PV013176	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human beta Thromboglobulin (beta-TG) ELISA Kit
abx574328-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Beta lactoglobulin, Beta-LG ELISA Kit
ELA-E1023h	Lifescience Market	96 Tests	EUR 824

Human Beta-TG(Beta-thromboglobulin) ELISA Kit
EH0874	FN Test	96T	EUR 524.1
Detection range: 0.312-20 ng/ml Alias: β-TG(β-Thromboglobulin)/Beta-TG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human beta Thromboglobulin (beta-TG) ELISA Kit
20-abx150805	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human beta Thromboglobulin (beta-TG) ELISA Kit
abx253398-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human beta Thromboglobulin (beta-TG) ELISA Kit
abx253830-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C
7-04999	CHI Scientific	5µg	Ask for price

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C
7-05000	CHI Scientific	20µg	Ask for price

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C
7-05001	CHI Scientific	1mg	Ask for price

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
abx117130-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx130940	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx130941	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx001375	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody
abx031648-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody
abx031648-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody
abx031649-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody
abx031649-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
abx028982-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
abx028982-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx339074	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx334159	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody
20-abx210645	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)
4-RPC444Hu01	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q96EV8 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.9kDa Isoelectric Point: 4.3
Description: Recombinant Human Dystrobrevin Binding Protein 1 expressed in: E.coli

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)
4-RPC444Mu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q91WZ8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Dystrobrevin Binding Protein 1 expressed in: E.coli

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)
4-RPC444Ra01	Cloud-Clone	EUR 395.68 EUR 209.00 EUR 1208.80 EUR 469.60 EUR 839.20 EUR 328.00 EUR 2872.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5M834 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.0kDa Isoelectric Point: Inquire
Description: Recombinant Rat Dystrobrevin Binding Protein 1 expressed in: E.coli

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Dtnb sgRNA CRISPR Lentivector set (Mouse)
K4670501	ABM	3 x 1.0 ug	EUR 339

Dtnb sgRNA CRISPR Lentivector set (Rat)
K6438701	ABM	3 x 1.0 ug	EUR 339

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit
KTE62451-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit
KTE62451-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit
KTE62451-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human beta Endorphin ELISA kit
E01E0219-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta Endorphin ELISA kit
E01E0219-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta Endorphin ELISA kit
E01E0219-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit
E01B0982-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit
E01B0982-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit
E01B0982-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit
E01B1010-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit
E01B1010-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit
E01B1010-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit
E01L0012-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit
E01L0012-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit
E01L0012-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta mannosidase ELISA Kit
ELA-E0197h	Lifescience Market	96 Tests	EUR 824

Human Beta-LI ELISA Kit
EHB0653	Abclonal	96Tests	EUR 521

Human Beta-APP42 ELISA Kit
ELA-E1151h	Lifescience Market	96 Tests	EUR 824

Human Klotho Beta ELISA Kit
ELA-E13546h	Lifescience Market	96 Tests	EUR 824

Human Beta- Defensins ELISA Kit
ELA-E1373h	Lifescience Market	96 Tests	EUR 824

Human Amylase Beta ELISA Kit
ELA-E2216h	Lifescience Market	96 Tests	EUR 824

Human Beta- galactoyl ELISA Kit
ELA-E2301h	Lifescience Market	96 Tests	EUR 824

TFIIE beta ELISA KIT|Human
EF003561	Lifescience Market	96 Tests	EUR 689

Tubulin-beta ELISA KIT|Human
EF003944	Lifescience Market	96 Tests	EUR 689

Beta-TG ELISA KIT|Human
EF001460	Lifescience Market	96 Tests	EUR 689

beta glucan ELISA KIT|Human
EF007360	Lifescience Market	96 Tests	EUR 689

Beta adducin ELISA KIT|Human
EF008106	Lifescience Market	96 Tests	EUR 689

Beta sarcoglycan ELISA KIT|Human
EF008107	Lifescience Market	96 Tests	EUR 689

Importin beta ELISA KIT|Human
EF010333	Lifescience Market	96 Tests	EUR 689

Human IL1 beta ELISA kit
55R-1605	Fitzgerald	1 kit	EUR 415
Description: ELISA kit for the detection of IL1 beta in the research laboratory

Human TNF beta ELISA kit
55R-1717	Fitzgerald	1 kit	EUR 415
Description: ELISA kit for the detection of TNF beta in the research laboratory

Human IFN beta ELISA kit
55R-2176	Fitzgerald	96 tests	EUR 766
Description: ELISA Kit for detection of IFNb in the research laboratory

Human TNF beta ELISA kit
55R-IB49601	Fitzgerald	96 wells	EUR 1178
Description: ELISA kit for the detection of TNF beta in the research laboratory

Human IL1 beta ELISA kit
55R-IB49624	Fitzgerald	96 wells	EUR 1178
Description: ELISA kit for the detection of IL1 beta in the research laboratory

Beta-NGF (human) ELISA Kit
K4787-100	Biovision	100 assays	EUR 834
Kit components: Beta-NGF Ab coated plate (Item A), 96 wells Wash Buffer Concentrate (20x) (Item B) Human Beta-NGF Standard (Item C) Assay Diluent (5x) (Item E) Biotinylated anti-human Beta-NGF Ab (Item F) HRP-Streptavidin Concentrate (8 Show more
Description: Sensitive, Colorimetric Assay

Human Beta-naphthol ELISA Kit
CN-04545H1	ChemNorm	96T	EUR 441

Human Beta-naphthol ELISA Kit
CN-04545H2	ChemNorm	48T	EUR 291

Human Elisa HIF1 beta Kit
QY-E05400	Qayee Biotechnology	96T	EUR 361

Human CSNK2 beta Elisa Kit
QY-E05401	Qayee Biotechnology	96T	EUR 361

Human Beta Amyloid ELISA Kit
QY-E05730	Qayee Biotechnology	96T	EUR 361

Human Beta-Hexosaminidase Subunit Beta (HEXB) ELISA Kit
abx570136-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Beta-Lipotropic Hormone (beta-LPH) ELISA Kit
abx575855-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

ELISA kit for Human Beta-hexosaminidase subunit beta
EK4847	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Beta-hexosaminidase subunit beta in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HEXB/ Beta-hexosaminidase subunit beta ELISA Kit
E1117Hu	Sunlong	1 Kit	EUR 605

Human HEXB(Beta-hexosaminidase subunit beta) ELISA Kit
EH2405	FN Test	96T	EUR 567.6
Detection range: 1.56-100IU/ml Uniprot ID: P07686 Alias: HEXB/ENC-1AS/N-acetyl-beta-glucosaminidase subunit beta/Beta-N-acetylhexosaminidase subunit beta(Hexosaminidase subunit B)/Cervical cancer proto-oncogene 7 protein(HCC-7)/ENC-1AS/HCC-7/HEL-248/ Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938IU/ml

Human Beta- hexosaminidase subunit beta, HEXB ELISA KIT
ELI-07642h	Lifescience Market	96 Tests	EUR 824

Human Beta-Lipotropic Hormone (beta-LPH) ELISA Kit
20-abx150815	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Beta-Endorphin Receptor (Beta-EPR) ELISA Kit
abx253394-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Human Beta mannosidase (Beta-Manase)
KTE62506-48T	Abbkine	48T	EUR 354
Beta-mannosidase (EC 3.2.1.25, mannanase, mannase, beta-D-mannosidase, beta-mannoside mannohydrolase, exo-beta-D-mannanase, lysosomal beta A mannosidase) is an enzyme with systematic name beta-D-mannoside mannohydrolase, which is in humans encoded by Show more
Description: Quantitative sandwich ELISA for measuring Human Beta mannosidase (Beta-Manase) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta mannosidase (Beta-Manase)
KTE62506-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Beta-mannosidase (EC 3.2.1.25, mannanase, mannase, beta-D-mannosidase, beta-mannoside mannohydrolase, exo-beta-D-mannanase, lysosomal beta A mannosidase) is an enzyme with systematic name beta-D-mannoside mannohydrolase, which is in humans encoded by Show more
Description: Quantitative sandwich ELISA for measuring Human Beta mannosidase (Beta-Manase) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta mannosidase (Beta-Manase)
KTE62506-96T	Abbkine	96T	EUR 572
Beta-mannosidase (EC 3.2.1.25, mannanase, mannase, beta-D-mannosidase, beta-mannoside mannohydrolase, exo-beta-D-mannanase, lysosomal beta A mannosidase) is an enzyme with systematic name beta-D-mannoside mannohydrolase, which is in humans encoded by Show more
Description: Quantitative sandwich ELISA for measuring Human Beta mannosidase (Beta-Manase) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Interferon beta (IFN-Beta)
KTE62921-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Interferon beta (IFN-Beta) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Interferon beta (IFN-Beta)
KTE62921-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Interferon beta (IFN-Beta) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Interferon beta (IFN-Beta)
KTE62921-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Interferon beta (IFN-Beta) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat)
4-PAC444Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1)

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Mouse Dystrobrevin Binding Protein 1 (DTNBP1) Protein
20-abx168964	Abbexa	EUR 551.00 EUR 244.00 EUR 1595.00 EUR 648.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Dystrobrevin Binding Protein 1 (DTNBP1) Protein
20-abx168965	Abbexa	EUR 565.00 EUR 258.00 EUR 1636.00 EUR 662.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dystrobrevin-Binding Protein 1 Isoform C Protein
20-abx262013	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody (HRP)
20-abx335472	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody (FITC)
20-abx335473	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody (Biotin)
20-abx335474	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Dtnb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4670502	ABM	1.0 ug DNA	EUR 154

Dtnb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4670503	ABM	1.0 ug DNA	EUR 154

Dtnb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4670504	ABM	1.0 ug DNA	EUR 154

Dtnb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6438702	ABM	1.0 ug DNA	EUR 154

Dtnb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6438703	ABM	1.0 ug DNA	EUR 154

Dtnb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6438704	ABM	1.0 ug DNA	EUR 154

DTNB Protein Vector (Mouse) (pPB-C-His)
PV173554	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPB-N-His)
PV173555	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPM-C-HA)
PV173556	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPM-C-His)
PV173557	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPB-C-His)
PV173558	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPB-N-His)
PV173559	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPM-C-HA)
PV173560	ABM	500 ng	EUR 603

DTNB Protein Vector (Mouse) (pPM-C-His)
PV173561	ABM	500 ng	EUR 603

DTNB Protein Vector (Rat) (pPB-C-His)
PV264970	ABM	500 ng	EUR 603

DTNB Protein Vector (Rat) (pPB-N-His)
PV264971	ABM	500 ng	EUR 603

DTNB Protein Vector (Rat) (pPM-C-HA)
PV264972	ABM	500 ng	EUR 603

DTNB Protein Vector (Rat) (pPM-C-His)
PV264973	ABM	500 ng	EUR 603

Dtnb 3'UTR Luciferase Stable Cell Line
TU203662	ABM	1.0 ml	Ask for price

Dtnb 3'UTR GFP Stable Cell Line
TU155421	ABM	1.0 ml	Ask for price

DTNB 3'UTR Luciferase Stable Cell Line
TU006359	ABM	1.0 ml	EUR 1521

Dtnb 3'UTR Luciferase Stable Cell Line
TU105421	ABM	1.0 ml	Ask for price

DTNB 3'UTR GFP Stable Cell Line
TU056359	ABM	1.0 ml	EUR 1521

Dtnb 3'UTR GFP Stable Cell Line
TU253662	ABM	1.0 ml	Ask for price

Human Beta-APP42/ Beta-amyloid protein 42 ELISA Kit
E0270Hu	Sunlong	1 Kit	EUR 571

Human Beta-defensin 5(Beta-defensin 105) ELISA Kit
EH4910	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Alias: Beta-defensin 105/Beta-defensin 5/BD-5/DEFB-5/Defensin, beta 105/DEFB105A/BD5/DEFB105/DEFB5/DEFB105B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Beta,beta- carotene 15,15'- monooxygenase, BCMO1 ELISA KIT
ELI-10937h	Lifescience Market	96 Tests	EUR 824

Human Beta- amyloid protein 42, Beta- APP42 ELISA KIT
ELI-03783h	Lifescience Market	96 Tests	EUR 824

Human Growth-regulated protein beta (GRO-beta) ELISA Kit
20-abx151748	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human SIRP BETA 1 (SIRP BETA 1) ELISA Kit
abx259843-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tumor Necrosis Factor Beta (TNF beta) ELISA Kit
abx252423-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Beta-Melanocyte Stimulating Hormone (beta-MSH) ELISA Kit
abx253397-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Beta,beta-carotene 15,15'-dioxygenase (BCO1) ELISA Kit
abx392200-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Interleukin-36 beta(Interleukin-36 beta) ELISA Kit
QY-E05579	Qayee Biotechnology	96T	EUR 361

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), APC
4-PAC444Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with APC.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAC444Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with Biotin.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), Cy3
4-PAC444Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with Cy3.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), FITC
4-PAC444Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with FITC.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), HRP
4-PAC444Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with HRP.

Dystrobrevin Binding Protein 1 (DTNBP1) Polyclonal Antibody (Human, Rat), PE
4-PAC444Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DTNBP1 (Asp110~Leu305) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Dystrobrevin Binding Protein 1 (DTNBP1). This antibody is labeled with PE.

DTNBP1 Dystrobrevin-Binding Protein 1 Isoform C Human Recombinant Protein
PROTQ96EV8	BosterBio	Regular: 20ug	EUR 317
Description: DTNBP1 Human Recombinant fused to 37 a.a. N-terminal His-Tag produced in E.Coli is a single, non-glycosylated polypeptide chain containing 307 amino acids (1-270a.a.) and having a molecular mass of 34.6 kDa.

Human Beta-Crosslaps (bCTx) ELISA Kit
CEA892Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Beta-Crosslaps (bCTx) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Beta-Crosslaps (bCTx) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.