Human JAG1(Jagged 1 Protein) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Jagged 1 Protein (JAG1) ELISA Kit |
RDR-JAG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
DLR-JAG1-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Jagged 1 Protein (JAG1) in samples from tissue homogenates or other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
DLR-JAG1-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Jagged 1 Protein (JAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Jagged 1 Protein (JAG1) in samples from tissue homogenates or other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
RD-JAG1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
RD-JAG1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
RDR-JAG1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
RDR-JAG1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Protein jagged-1 (JAG1) ELISA Kit |
abx570714-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human JAG1/ Protein jagged-1 ELISA Kit |
E1358Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Jagged 1 Protein (JAG1) ELISA Kit |
20-abx152071 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protein jagged-1(JAG1) ELISA kit |
CSB-EL011927HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1 (JAG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein jagged-1(JAG1) ELISA kit |
1-CSB-EL011927HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein jagged-1(JAG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 1 Protein (JAG1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Jagged 1 Protein (JAG1) ELISA Kit |
4-SEB807Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339
- AGS
- AHD
- AWS
- HJ1
- JAGL1
- Alagille Syndrome
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 1 Protein (JAG1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Jagged 1 Protein ELISA Kit (JAG1) |
RK01715 |
Abclonal |
96 Tests |
EUR 521 |
Human Jagged 1 Protein (JAG1) Protein |
20-abx067570 |
Abbexa |
-
EUR 606.00
-
EUR 258.00
-
EUR 1817.00
-
EUR 718.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Jagged 1 Protein (JAG1) Protein |
20-abx067571 |
Abbexa |
-
EUR 606.00
-
EUR 258.00
-
EUR 1817.00
-
EUR 718.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Jagged 1 Protein (JAG1) Protein |
20-abx067572 |
Abbexa |
-
EUR 606.00
-
EUR 258.00
-
EUR 1817.00
-
EUR 718.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Protein jagged-1 (JAG1) ELISA Kit |
abx571056-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Jag1/ Protein jagged-1 ELISA Kit |
E0537Ra |
Sunlong |
1 Kit |
EUR 571 |
Mouse Jag1/ Protein jagged-1 ELISA Kit |
E0818Mo |
Sunlong |
1 Kit |
EUR 571 |
Rat Jag1(Protein jagged-1) ELISA Kit |
ER0639 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q63722
- Alias: Jag1/CD339/AGS/AHDMGC104644/Alagille syndrome/AWS/CD339/CD339 antigen/HJ1/hJ1/jagged 1/Jagged1/JAGL1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
20-abx154277 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Protein jagged-1 (JAG1) ELISA Kit |
abx256614-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
SEB807Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Jagged 1 Protein (JAG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Jagged 1 Protein (JAG1) in Tissue homogenates and other biological fluids. |
Mouse Jagged 1 Protein (JAG1) ELISA Kit |
4-SEB807Mu |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Jagged 1 Protein elisa. Alternative names of the recognized antigen: CD339
- AGS
- AHD
- AWS
- HJ1
- JAGL1
- Alagille Syndrome
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Jagged 1 Protein (JAG1) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Jagged 1 Protein ELISA Kit (JAG1) |
RK02964 |
Abclonal |
96 Tests |
EUR 521 |
Jagged 1 Protein (JAG1) Antibody |
20-abx129567 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Jagged 1 Protein (JAG1) Antibody |
20-abx101517 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Jagged 1 Protein (JAG1) Antibody |
20-abx101518 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Jagged 1 Protein (JAG1) Antibody |
20-abx101519 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Jagged-1 (JAG1) Antibody |
abx037271-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody |
abx038125-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Jagged 1 Protein (JAG1) Antibody |
20-abx173207 |
Abbexa |
|
|
|
Jagged 1 Protein (JAG1) Antibody |
20-abx177228 |
Abbexa |
|
|
|
Protein Jagged-1 (JAG1) Antibody |
20-abx327592 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody |
20-abx213868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody |
20-abx214943 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody |
abx216340-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody |
abx431368-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Protein Jagged-1 (JAG1) Antibody |
20-abx302273 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Protein jagged-1 (Jag1) |
1-CSB-EP870758MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Protein jagged-1(Jag1),partial expressed in E.coli |
Recombinant Jagged 1 Protein (JAG1) |
4-RPB807Hu01 |
Cloud-Clone |
-
EUR 431.52
-
EUR 218.00
-
EUR 1343.20
-
EUR 514.40
-
EUR 928.80
-
EUR 352.00
-
EUR 3208.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78504
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli |
Recombinant Jagged 1 Protein (JAG1) |
4-RPB807Hu02 |
Cloud-Clone |
-
EUR 431.52
-
EUR 218.00
-
EUR 1343.20
-
EUR 514.40
-
EUR 928.80
-
EUR 352.00
-
EUR 3208.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78504
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli |
Recombinant Jagged 1 Protein (JAG1) |
4-RPB807Hu03 |
Cloud-Clone |
-
EUR 431.52
-
EUR 218.00
-
EUR 1343.20
-
EUR 514.40
-
EUR 928.80
-
EUR 352.00
-
EUR 3208.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78504
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.3kDa
- Isoelectric Point: 5.7
|
Description: Recombinant Human Jagged 1 Protein expressed in: E.coli |
Recombinant Jagged 1 Protein (JAG1) |
4-RPB807Mu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9QXX0
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.0kDa
- Isoelectric Point: 6.7
|
Description: Recombinant Mouse Jagged 1 Protein expressed in: E.coli |
ELISA kit for Human JAG1 (Jagged 1 Protein) |
ELK3156 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P
- Show more
|
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Jagged 1 Protein (JAG1) CLIA Kit |
20-abx493101 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Recombinant Human Jagged-1/JAG1 Protein |
RP00877 |
Abclonal |
10 μg |
EUR 221 |
Mouse Jagged 1 Protein (JAG1) Protein |
20-abx165879 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse JAG1 (Jagged 1 Protein) |
ELK3597 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 1 Protein (JAG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 1 P
- Show more
|
Description: A sandwich ELISA kit for detection of Jagged 1 Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Jag1 ELISA Kit| Rat Protein jagged-1 ELISA Kit |
EF017455 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Jagged 1 Protein (JAG1) CLIA Kit |
20-abx493102 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Jagged 1 Protein (JAG1) Antibody (Biotin) |
20-abx274491 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1247.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Jagged-1 (JAG1) Antibody (HRP) |
20-abx315963 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody (FITC) |
20-abx315964 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Jagged-1 (JAG1) Antibody (Biotin) |
20-abx315965 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Jagged 1 Protein (JAG1) Antibody (Biotin) |
20-abx272192 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Jagged 1 (JAG1) polyclonal antibody |
ABP-PAB-10531 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse) |
4-PAB807Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1) |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat) |
4-PAB807Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1) |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat) |
4-PAB807Hu02 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1) |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC |
4-PAB807Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAB807Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAB807Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC |
4-PAB807Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP |
4-PAB807Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE |
4-PAB807Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC |
4-PAB807Hu02-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAB807Hu02-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Biotin. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAB807Hu02-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with Cy3. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), FITC |
4-PAB807Hu02-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with FITC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), HRP |
4-PAB807Hu02-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with HRP. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), PE |
4-PAB807Hu02-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with PE. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig) |
4-PAB807Hu03 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1) |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC |
4-PAB807Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB807Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Biotin. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), Cy3 |
4-PAB807Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with Cy3. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), FITC |
4-PAB807Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with FITC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), HRP |
4-PAB807Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with HRP. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), PE |
4-PAB807Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with PE. |
Recombinant Human Jagged-1/JAG1/CD339 (C-Fc) |
CB95-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Jagged-1/JAG1/CD339 (C-Fc) |
CB95-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Jagged-1/JAG1/CD339 (C-Fc) |
CB95-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Jagged-1/JAG1/CD339 (C-Fc) |
CB95-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Polyclonal JAG1 / Jagged 1 Antibody (aa110-125) |
AMM06032G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 / Jagged 1 (aa110-125). This antibody is tested and proven to work in the following applications: |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAB807Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly33~Asp250)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAB807Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Gly470~Thr834)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC |
4-PAB807Hu03-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated |
4-PAB807Hu03-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Biotin. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), Cy3 |
4-PAB807Hu03-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with Cy3. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), FITC |
4-PAB807Hu03-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with FITC. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), HRP |
4-PAB807Hu03-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with HRP. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), PE |
4-PAB807Hu03-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with PE. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB807Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Ser826~Cys1084)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7. |
Jagged 1 Protein (JAG1) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7 |
4-PAB807Hu03-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: JAG1 (Val836~Ser1047)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Jagged 1 Protein (JAG1). This antibody is labeled with APC-Cy7. |
Human Jagged 1 Protein ELISA kit |
E01J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Jagged 1 Protein ELISA kit |
E01J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Jagged 1 Protein ELISA kit |
E01J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Protein jagged-1 |
EK4347 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Goat Jagged 1 Protein ELISA kit |
E06J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Jagged 1 Protein ELISA kit |
E06J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Jagged 1 Protein ELISA kit |
E06J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Jagged 1 Protein ELISA kit |
E02J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Jagged 1 Protein ELISA kit |
E02J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Jagged 1 Protein ELISA kit |
E02J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Jagged 1 Protein ELISA kit |
E03J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Jagged 1 Protein ELISA kit |
E03J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Jagged 1 Protein ELISA kit |
E03J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Jagged 1 Protein ELISA kit |
E04J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Jagged 1 Protein ELISA kit |
E04J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Jagged 1 Protein ELISA kit |
E04J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Jagged 1 Protein ELISA kit |
E08J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Jagged 1 Protein ELISA kit |
E08J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Jagged 1 Protein ELISA kit |
E08J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Jagged 1 Protein ELISA kit |
E07J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Jagged 1 Protein ELISA kit |
E07J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Jagged 1 Protein ELISA kit |
E07J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Jagged 1 Protein ELISA kit |
E09J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Jagged 1 Protein ELISA kit |
E09J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Jagged 1 Protein ELISA kit |
E09J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Jagged 1 Protein ELISA kit |
E05J0006-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Jagged 1 Protein ELISA kit |
E05J0006-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Jagged 1 Protein ELISA kit |
E05J0006-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Jagged 1 Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Rat Protein jagged-1 |
EK4348 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Protein jagged-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
JAG1 ELISA Kit (Human) (OKCD02666) |
OKCD02666 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. Enhances fibroblast growth factor-induced angiogenesis (in vitro).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
Human Protein Jagged-2 (JAG2) ELISA Kit |
abx573196-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human Jagged 2 Protein (JAG2) ELISA Kit |
20-abx152072 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Jagged 2 Protein (JAG2) ELISA Kit |
DLR-JAG2-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
DLR-JAG2-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Jagged 2 Protein (JAG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Jagged 2 Protein (JAG2) in samples from serum, plasma or other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
RD-JAG2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Jagged 2 Protein (JAG2) ELISA Kit |
RD-JAG2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Jagged 2 Protein (JAG2) ELISA Kit |
RDR-JAG2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Jagged 2 Protein (JAG2) ELISA Kit |
RDR-JAG2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Jagged 2 Protein (JAG2) ELISA Kit |
SEL636Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
SEL636Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
SEL636Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
SEL636Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Jagged 2 Protein (JAG2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Jagged 2 Protein (JAG2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Jagged 2 Protein (JAG2) ELISA Kit |
4-SEL636Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Jagged 2 Protein elisa. Alternative names of the recognized antigen: HJ2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Jagged 2 Protein (JAG2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Jagged 1 Antibody |
48255-100ul |
SAB |
100ul |
EUR 333 |
Jagged 1 Antibody |
48255-50ul |
SAB |
50ul |
EUR 239 |
ELISA kit for Human JAG2 (Jagged 2 Protein) |
ELK7225 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Jagged 2 Protein (JAG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Jagged 2 P
- Show more
|
Description: A sandwich ELISA kit for detection of Jagged 2 Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
JAG1 ELISA Kit (Mouse) (OKCD02667) |
OKCD02667 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 6.1 pg/mL |
JAG1 ELISA Kit (Rat) (OKEH03468) |
OKEH03468 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Enhances fibroblast growth factor-induced angiogenesis (in vitro). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation. May regulate fibroblast growth factor-induced angiogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL |
Mouse Protein Jagged-2 (JAG2) ELISA Kit |
abx555988-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Protein Jagged-2 (JAG2) ELISA Kit |
abx556259-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Jag2/ Protein jagged-2 ELISA Kit |
E0819Mo |
Sunlong |
1 Kit |
EUR 632 |
Polyclonal Jagged 1 Antibody |
AMM06036G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Jagged 1 . This antibody is tested and proven to work in the following applications: |
Jagged 1 Conjugated Antibody |
C48255 |
SAB |
100ul |
EUR 397 |
Jagged 1 Blocking Peptide |
3101BP-50 |
Biovision |
|
EUR 153 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Jag2 ELISA Kit| Rat Protein jagged-2 ELISA Kit |
EF018869 |
Lifescience Market |
96 Tests |
EUR 689 |
Jag2 ELISA Kit| Mouse Protein jagged-2 ELISA Kit |
EF015300 |
Lifescience Market |
96 Tests |
EUR 689 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Recombinant human Protein jagged-2 |
P1266 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9Y219
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Protein jagged-2 |
Human Jagged 2 Protein (JAG2) CLIA Kit |
20-abx495948 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
JAG1 siRNA |
20-abx902742 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
JAG1 siRNA |
20-abx921012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
JAG1 siRNA |
20-abx921013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
JAG1 Antibody |
37668-100ul |
SAB |
100ul |
EUR 252 |
JAG1 Antibody |
39567-100ul |
SAB |
100ul |
EUR 390 |
JAG1 Antibody |
DF8269 |
Affbiotech |
200ul |
EUR 304 |
Description: JAG1 Antibody detects endogenous levels of total JAG1. |
JAG1 Antibody |
1-CSB-PA969766 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
JAG1 Antibody |
1-CSB-PA005638 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
JAG1 Antibody |
1-CSB-PA234352 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
JAG1 Antibody |
1-CSB-PA01949A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against JAG1. Recognizes JAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Human Jagged 2 Protein (JAG2) Protein |
20-abx067574 |
Abbexa |
-
EUR 634.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Jagged 1 Protein (Gln 34-Asp 1067) |
VAng-1857Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 6099 |
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1) |
Human Jagged 1 Protein (Gln 34-Asp 1067) |
VAng-1857Lsx-50g |
Creative Biolabs |
50 µg |
EUR 848 |
Description: Human Jagged 1 (JAG1) protein, expressed in human 293 cells. (Uniprot ID: P78504-1) |
Human JAG1 shRNA Plasmid |
20-abx950128 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
JAG1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1109302 |
ABM |
1.0 ug DNA |
EUR 154 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Polyclonal JAG1 Antibody |
AMM06033G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JAG1 . This antibody is tested and proven to work in the following applications: |
JAG1 Conjugated Antibody |
C37668 |
SAB |
100ul |
EUR 397 |
JAG1 cloning plasmid |
CSB-CL011927HU-10ug |
Cusabio |
10ug |
EUR 1291 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3657
- Sequence: atgcgttccccacggacgcgcggccggtccgggcgccccctaagcctcctgctcgccctgctctgtgccctgcgagccaaggtgtgtggggcctcgggtcagttcgagttggagatcctgtccatgcagaacgtgaacggggagctgcagaacgggaactgctgcggcggcgccc
- Show more
|
Description: A cloning plasmid for the JAG1 gene. |
JAG1 Rabbit pAb |
A12733-100ul |
Abclonal |
100 ul |
EUR 308 |
JAG1 Rabbit pAb |
A12733-200ul |
Abclonal |
200 ul |
EUR 459 |
JAG1 Rabbit pAb |
A12733-20ul |
Abclonal |
20 ul |
EUR 183 |
JAG1 Rabbit pAb |
A12733-50ul |
Abclonal |
50 ul |
EUR 223 |
JAG1 Rabbit pAb |
A12754-100ul |
Abclonal |
100 ul |
EUR 308 |
JAG1 Rabbit pAb |
A12754-200ul |
Abclonal |
200 ul |
EUR 459 |
JAG1 Rabbit pAb |
A12754-20ul |
Abclonal |
20 ul |
EUR 183 |
JAG1 Rabbit pAb |
A12754-50ul |
Abclonal |
50 ul |
EUR 223 |
JAG1 Blocking Peptide |
DF8269-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-JAG1 antibody |
STJ114606 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. |
Anti-JAG1 antibody |
STJ114627 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The jagged 1 protein encoded by JAG1 is the human homolog of the Drosophilia jagged protein. Human jagged 1 is the ligand for the receptor notch 1, the latter a human homolog of the Drosophilia jagged receptor notch. Mutations that alter the jagged 1 protein cause Alagille syndrome. Jagged 1 signalling through notch 1 has also been shown to play a role in hematopoiesis. |