Human BLMH(Bleomycin Hydrolase) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
RD-BLMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
RD-BLMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
RDR-BLMH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
RDR-BLMH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Bleomycin hydrolase(BLMH) ELISA kit |
E01B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
E01B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
E01B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
20-abx150813 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Bleomycin hydrolase(BLMH) ELISA kit |
CSB-EL002716HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Bleomycin hydrolase(BLMH) ELISA kit |
1-CSB-EL002716HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
SEC220Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
SEC220Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
SEC220Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
SEC220Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) ELISA Kit |
4-SEC220Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
- BMH
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Bleomycin Hydrolase ELISA Kit (BLMH) |
RK00979 |
Abclonal |
96 Tests |
EUR 521 |
Bleomycin Hydrolase (BLMH) Antibody |
20-abx111231 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx101837 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx101838 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx101839 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx101840 |
Abbexa |
-
EUR 342.00
-
EUR 871.00
-
EUR 453.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
abx034944-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
abx034944-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx005014 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx320093 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx321698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
abx230907-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Bleomycin Hydrolase (BLMH) Antibody |
20-abx171422 |
Abbexa |
|
|
|
Recombinant Bleomycin Hydrolase (BLMH) |
4-RPC220Hu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q13867
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Bleomycin Hydrolase expressed in: E.coli |
Recombinant Bleomycin Hydrolase (BLMH) |
4-RPC220Mu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8R016
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Bleomycin Hydrolase expressed in: E.coli |
Recombinant Bleomycin Hydrolase (BLMH) |
4-RPC220Ra01 |
Cloud-Clone |
-
EUR 332.96
-
EUR 192.00
-
EUR 973.60
-
EUR 391.20
-
EUR 682.40
-
EUR 286.00
-
EUR 2284.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P70645
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Bleomycin Hydrolase expressed in: E.coli |
Goat Bleomycin hydrolase(BLMH) ELISA kit |
E06B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bleomycin hydrolase(BLMH) ELISA kit |
E06B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Bleomycin hydrolase(BLMH) ELISA kit |
E06B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bleomycin hydrolase(BLMH) ELISA kit |
E02B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bleomycin hydrolase(BLMH) ELISA kit |
E02B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Bleomycin hydrolase(BLMH) ELISA kit |
E02B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bleomycin hydrolase(BLMH) ELISA kit |
E03B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bleomycin hydrolase(BLMH) ELISA kit |
E03B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Bleomycin hydrolase(BLMH) ELISA kit |
E03B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bleomycin hydrolase(BLMH) ELISA kit |
E04B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bleomycin hydrolase(BLMH) ELISA kit |
E04B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bleomycin hydrolase(BLMH) ELISA kit |
E04B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bleomycin hydrolase(BLMH) ELISA kit |
E07B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bleomycin hydrolase(BLMH) ELISA kit |
E07B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Bleomycin hydrolase(BLMH) ELISA kit |
E07B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bleomycin hydrolase(BLMH) ELISA kit |
E09B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bleomycin hydrolase(BLMH) ELISA kit |
E09B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Bleomycin hydrolase(BLMH) ELISA kit |
E09B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bleomycin hydrolase(BLMH) ELISA kit |
E08B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bleomycin hydrolase(BLMH) ELISA kit |
E08B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Bleomycin hydrolase(BLMH) ELISA kit |
E08B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Chicken Bleomycin hydrolase, BLMH ELISA KIT |
ELI-11925c |
Lifescience Market |
96 Tests |
EUR 928 |
Rabbit Bleomycin hydrolase, BLMH ELISA KIT |
ELI-33313Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Bleomycin Hydrolase (BLMH) ELISA Kit |
abx388691-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Bleomycin Hydrolase (BLMH) ELISA Kit |
abx391026-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Bleomycin Hydrolase (BLMH) Protein |
20-abx065545 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Bleomycin Hydrolase (BLMH) CLIA Kit |
20-abx190301 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Bleomycin Hydrolase (BLMH)CLIA Kit |
SCC220Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH)CLIA Kit |
SCC220Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH)CLIA Kit |
SCC220Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH)CLIA Kit |
SCC220Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH) in Tissue homogenates and other biological fluids. |
Human Bleomycin Hydrolase (BLMH) CLIA Kit |
4-SCC220Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3061.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Bleomycin Hydrolase Clia kit. Alternative names of the recognized antigen: BH
- BMH
|
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Bleomycin Hydrolase (BLMH)Tissue homogenates and other biological fluids |
ELISA kit for Human BLMH (Bleomycin Hydrolase) |
ELK3153 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc
- Show more
|
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Bleomycin Hydrolase (BLMH) Protein |
20-abx065546 |
Abbexa |
-
EUR 481.00
-
EUR 230.00
-
EUR 1330.00
-
EUR 551.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Bleomycin Hydrolase (BLMH) Protein |
20-abx065547 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bleomycin Hydrolase (BLMH) Antibody (FITC) |
20-abx273637 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Bleomycin Hydrolase (BLMH) Antibody (Biotin) |
20-abx272261 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Bleomycin Hydrolase (BLMH) Antibody (Biotin) |
20-abx273337 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Guinea pig Bleomycin hydrolase(BLMH) ELISA kit |
E05B0805-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Bleomycin hydrolase(BLMH) ELISA kit |
E05B0805-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Bleomycin hydrolase(BLMH) ELISA kit |
E05B0805-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human) |
4-PAC220Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH) |
BLMH Bleomycin Hydrolase Human Recombinant Protein |
PROTQ13867 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: BLMH produced in E.Coli is a single, non-glycosylated polypeptide chain containing 475 amino acids (1-455a.a.) and having a molecular mass of 54.7kDa.;BLMH is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Blmh ELISA Kit| Rat Bleomycin hydrolase ELISA Kit |
EF018379 |
Lifescience Market |
96 Tests |
EUR 689 |
BLMH ELISA Kit| chicken Bleomycin hydrolase ELISA Kit |
EF012220 |
Lifescience Market |
96 Tests |
EUR 689 |
Blmh ELISA Kit| Mouse Bleomycin hydrolase ELISA Kit |
EF014316 |
Lifescience Market |
96 Tests |
EUR 689 |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse) |
4-PAC220Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH) |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat) |
4-PAC220Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH) |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat) |
4-MAC220Ra21 |
Cloud-Clone |
-
EUR 260.00
-
EUR 2721.00
-
EUR 673.00
-
EUR 329.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH) |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC |
4-PAC220Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Biotinylated |
4-PAC220Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), Cy3 |
4-PAC220Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), FITC |
4-PAC220Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), HRP |
4-PAC220Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), PE |
4-PAC220Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with PE. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC |
4-PAC220Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC220Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), Cy3 |
4-PAC220Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), FITC |
4-PAC220Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), HRP |
4-PAC220Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), PE |
4-PAC220Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with PE. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC |
4-PAC220Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Biotinylated |
4-PAC220Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), Cy3 |
4-PAC220Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), FITC |
4-PAC220Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), HRP |
4-PAC220Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), PE |
4-PAC220Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC |
4-MAC220Ra21-APC |
Cloud-Clone |
-
EUR 365.00
-
EUR 3563.00
-
EUR 984.00
-
EUR 468.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Biotinylated |
4-MAC220Ra21-Biotin |
Cloud-Clone |
-
EUR 326.00
-
EUR 2671.00
-
EUR 780.00
-
EUR 402.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Biotin. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), Cy3 |
4-MAC220Ra21-Cy3 |
Cloud-Clone |
-
EUR 445.00
-
EUR 4709.00
-
EUR 1271.00
-
EUR 583.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with Cy3. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), FITC |
4-MAC220Ra21-FITC |
Cloud-Clone |
-
EUR 312.00
-
EUR 2870.00
-
EUR 807.00
-
EUR 395.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with FITC. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), HRP |
4-MAC220Ra21-HRP |
Cloud-Clone |
-
EUR 333.00
-
EUR 3104.00
-
EUR 869.00
-
EUR 422.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with HRP. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), PE |
4-MAC220Ra21-PE |
Cloud-Clone |
-
EUR 312.00
-
EUR 2870.00
-
EUR 807.00
-
EUR 395.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with PE. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC220Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Met213~Trp447)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC220Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Ala27~Cys164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7. |
Bleomycin Hydrolase (BLMH) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC220Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BLMH (Val30~Phe165)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7. |
Bleomycin Hydrolase (BLMH) Monoclonal Antibody (Rat), APC-Cy7 |
4-MAC220Ra21-APC-Cy7 |
Cloud-Clone |
-
EUR 610.00
-
EUR 7006.00
-
EUR 1849.00
-
EUR 817.00
-
EUR 337.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Val30~Phe165
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Rat Bleomycin Hydrolase (BLMH). This antibody is labeled with APC-Cy7. |
Bleomycin Hydrolase (Recombinant) |
20-abx073168 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Recombinant Human Bleomycin Hydrolase |
7-02527 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Bleomycin Hydrolase |
7-02528 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Bleomycin Hydrolase |
7-02529 |
CHI Scientific |
1mg |
Ask for price |
BLMH ELISA Kit (Human) (OKCD00313) |
OKCD00313 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: The normal physiological role of BLM hydrolase is unknown, but it catalyzes the inactivation of the antitumor drug BLM (a glycopeptide) by hydrolyzing the carboxamide bond of its B-aminoalaninamide moiety thus protecting normal and malignant cells from BLM toxicity.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
BLMH ELISA Kit (Human) (OKAN06156) |
OKAN06156 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL |
BLMH ELISA Kit (Human) (OKDD00151) |
OKDD00151 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.071 ng/mL |
Bleomycin |
B053-10MG |
TOKU-E |
10 mg |
EUR 224 |
Bleomycin |
B053-50MG |
TOKU-E |
50 mg |
EUR 708 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Recombinant BLMH |
6392-100 |
Biovision |
|
EUR 457 |
Bleomycin Sulfate |
A8331-10 |
ApexBio |
10 mg |
EUR 187 |
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus. |
Bleomycin Sulfate |
A8331-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 340 |
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus. |
Bleomycin Sulfate |
A8331-50 |
ApexBio |
50 mg |
EUR 593 |
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus. |
Bleomycin Sulfate |
A8331-S |
ApexBio |
Evaluation Sample |
EUR 81 |
Description: Bleomycin sulfate (BLENOXANE®) is a mixture of cytotoxic glycopeptide antibiotics produced by a strain of streptomyces verticillus. |
BLMH Chemi-Luminescent ELISA Kit (Human) (OKCD03322) |
OKCD03322 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: The normal physiological role of BLM hydrolase is unknown, but it catalyzes the inactivation of the antitumor drug BLM (a glycopeptide) by hydrolyzing the carboxamide bond of its B-aminoalaninamide moiety thus protecting normal and malignant cells from BLM toxicity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
BLMH siRNA |
20-abx909134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BLMH siRNA |
20-abx909135 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BLMH antibody |
70R-2880 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal BLMH antibody raised against the middle region of BLMH |
BLMH Antibody |
35402-100ul |
SAB |
100ul |
EUR 390 |
BLMH antibody |
38988-100ul |
SAB |
100ul |
EUR 252 |
BLMH antibody |
10R-1335 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal BLMH antibody |
BLMH antibody |
70R-16004 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BLMH antibody |
BLMH Antibody |
DF12855 |
Affbiotech |
200ul |
EUR 304 |
Description: BLMH Antibody detects endogenous levels of BLMH. |
BLMH Antibody |
1-CSB-PA002716ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
BLMH Antibody |
1-CSB-PA002716ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
BLMH Antibody |
1-CSB-PA002716GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against BLMH. Recognizes BLMH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti-BLMH |
YF-PA10486 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to BLMH |
anti-BLMH |
YF-PA23303 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to BLMH |
Human BLMH shRNA Plasmid |
20-abx950438 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BLMH Recombinant Protein (Human) |
RP003082 |
ABM |
100 ug |
Ask for price |
Bleomycin A5 hydrochloride |
B004-10MG |
TOKU-E |
10 mg |
EUR 188 |
Bleomycin A5 hydrochloride |
B004-50MG |
TOKU-E |
50 mg |
EUR 397 |
Bleomycin sulfate USP |
B005-10MG |
TOKU-E |
10 mg |
EUR 210 |
Bleomycin sulfate USP |
B005-50MG |
TOKU-E |
50 mg |
EUR 575 |
Bleomycin A5 (hydrochloride) |
C3370-10 |
ApexBio |
10 mg |
EUR 328 |
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma. |
Bleomycin A5 (hydrochloride) |
C3370-25 |
ApexBio |
25 mg |
EUR 659 |
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma. |
Bleomycin A5 (hydrochloride) |
C3370-5 |
ApexBio |
5 mg |
EUR 206 |
Description: Bleomycin A5 is an anticancer chemotherapeutic that binds DNA and induces DNA cleavage and strand breaks, it is highly toxic. Additionally, this compound induces apoptosis, alters cell cycle regulation, inhibits proliferation, and decreases tumor size in cellular and animal models of hemangioma. |
BLMH Conjugated Antibody |
C38988 |
SAB |
100ul |
EUR 397 |
BLMH cloning plasmid |
CSB-CL002716HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1368
- Sequence: atgagcagctcgggactgaattcggagaaggtagctgctctgatacagaaactgaattccgacccccagttcgtacttgcccagaatgtcgggaccacccacgacctgctggacatctgtctgaagcgggccacggtgcagcgcgcgcagcatgtgttccagcacgccgtgcccc
- Show more
|
Description: A cloning plasmid for the BLMH gene. |
anti- BLMH antibody |
FNab00907 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:20 - 1:50
- Immunogen: bleomycin hydrolase
- Uniprot ID: Q13867
- Gene ID: 642
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against BLMH |
BLMH Rabbit pAb |
A6535-100ul |
Abclonal |
100 ul |
EUR 308 |
BLMH Rabbit pAb |
A6535-200ul |
Abclonal |
200 ul |
EUR 459 |
BLMH Rabbit pAb |
A6535-20ul |
Abclonal |
20 ul |
EUR 183 |
BLMH Rabbit pAb |
A6535-50ul |
Abclonal |
50 ul |
EUR 223 |
BLMH Blocking Peptide |
33R-2825 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BLMH antibody, catalog no. 70R-2880 |
BLMH Blocking Peptide |
DF12855-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-BLMH antibody |
STJ28618 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily. |
Anti-BLMH (4A2) |
YF-MA10095 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BLMH |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
E01A1552-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
E01A1552-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
E01A1552-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human γ Glutamate Hydrolase ELISA kit |
E01G0559-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human γ Glutamate Hydrolase ELISA kit |
E01G0559-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human γ Glutamate Hydrolase ELISA kit |
E01G0559-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
E01H0015-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
E01H0015-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit |
E01H0015-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit |
EH3210 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q16775
- Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Valacyclovir hydrolase, BPHL ELISA KIT |
ELI-11153h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Acyloxyacyl hydrolase, AOAH ELISA KIT |
ELI-34429h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
20-abx150541 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
20-abx151482 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Valacyclovir Hydrolase (BPHL) ELISA Kit |
20-abx386067 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit |
abx252611-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit |
201-12-2818 |
SunredBio |
96 tests |
EUR 440 |
- This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
DLR-AOAH-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
DLR-AOAH-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
CSB-EL001853HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Acyloxyacyl hydrolase(AOAH) ELISA kit |
1-CSB-EL001853HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Fumarylacetoacetate Hydrolase ELISA Kit (FAH) |
RK01355 |
Abclonal |
96 Tests |
EUR 521 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
RD-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
RD-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
RDR-AOAH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
RDR-AOAH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit |
QY-E01881 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
SEJ123Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
SEJ123Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
SEJ123Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
SEJ123Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids. |
Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit |
4-SEJ123Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
- Fumarylacetoacetase
- Tyrosinemia 1
- Beta-diketonase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
SEJ634Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
SEJ634Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
SEJ634Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
SEJ634Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit |
4-SEJ634Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |