Human SYCN(Syncollin) ELISA Kit

Human SYCN(Syncollin) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Syncollin (SYCN) ELISA Kit
RDR-SYCN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Syncollin (SYCN) ELISA Kit
20-abx153204	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Syncollin (SYCN) ELISA Kit
abx253231-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human SYCN(Syncollin) ELISA Kit
EH3837	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q0VAF6 Alias: SYCN/Syncollin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Syncollin, SYCN ELISA KIT
ELI-52181h	Lifescience Market	96 Tests	EUR 824

Human Syncollin(SYCN)ELISA Kit
QY-E04566	Qayee Biotechnology	96T	EUR 361

Human Syncollin (SYCN) ELISA Kit
SED879Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
SED879Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids.

Human Syncollin (SYCN) ELISA Kit
4-SED879Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Syncollin elisa. Alternative names of the recognized antigen: SYL INSSA1 Insulin Synthesis Associated 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncollin (SYCN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Syncollin, Sycn ELISA KIT
ELI-53111m	Lifescience Market	96 Tests	EUR 865

Rat Syncollin (Sycn) ELISA Kit
abx392037-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Syncollin (SYCN) ELISA Kit
abx354644-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Syncollin (SYCN) ELISA Kit
abx354939-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Syncollin (SYCN) ELISA Kit
abx355086-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Syncollin (SYCN) ELISA Kit
abx355322-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Syncollin (Sycn) ELISA Kit
abx390692-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Syncollin (SYCN) Antibody
20-abx131613	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Syncollin (SYCN) Antibody
20-abx174694	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Syncollin (SYCN) Antibody
20-abx305475	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Syncollin (SYCN)
4-RPD879Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q0VAF6 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Syncollin expressed in: E.coli

ELISA kit for Human SYCN (Syncollin)
E-EL-H1005	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SYCN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SYCN (Syncollin)
ELK3086	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncollin (SYCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncollin (SYCN). Show more
Description: A sandwich ELISA kit for detection of Syncollin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Syncollin (SYCN)
KTE60408-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncollin (SYCN)
KTE60408-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncollin (SYCN)
KTE60408-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncollin (SYCN) CLIA Kit
abx197741-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Syncollin (SYCN) CLIA Kit
20-abx494426	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Syncollin (SYCN) Protein
20-abx650526	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Syncollin (SYCN) Antibody (HRP)
20-abx305476	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncollin (SYCN) Antibody (FITC)
20-abx305477	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncollin (SYCN) Antibody (Biotin)
20-abx305478	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sycn ELISA Kit| Rat Syncollin ELISA Kit
EF019397	Lifescience Market	96 Tests	EUR 689

Sycn ELISA Kit| Mouse Syncollin ELISA Kit
EF016335	Lifescience Market	96 Tests	EUR 689

CLIA kit for Human SYCN (Syncollin)
E-CL-H0677	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's SYCN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant

Syncollin (SYCN) Polyclonal Antibody (Human)
4-PAD879Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN)

Syncollin (SYCN) Polyclonal Antibody (Human), APC
4-PAD879Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC.

Syncollin (SYCN) Polyclonal Antibody (Human), Biotinylated
4-PAD879Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Biotin.

Syncollin (SYCN) Polyclonal Antibody (Human), Cy3
4-PAD879Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Cy3.

Syncollin (SYCN) Polyclonal Antibody (Human), FITC
4-PAD879Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with FITC.

Syncollin (SYCN) Polyclonal Antibody (Human), HRP
4-PAD879Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with HRP.

Syncollin (SYCN) Polyclonal Antibody (Human), PE
4-PAD879Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with PE.

Syncollin (SYCN) Polyclonal Antibody (Human), APC-Cy7
4-PAD879Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYCN (Cys38~Ser134) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC-Cy7.

Sycn/ Rat Sycn ELISA Kit
ELI-23601r	Lifescience Market	96 Tests	EUR 886

SYCN ELISA KIT|Human
EF007197	Lifescience Market	96 Tests	EUR 689

SYCN ELISA Kit (Human) (OKCD08556)
OKCD08556	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: SYCN functions in exocytosis in pancreatic acinar cells regulating the fusion of zymogen granules with each other. SYCN may have a pore-forming activity on membranes and regulate exocytosis in other exocrine tissues.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

SYCN ELISA Kit (Human) (OKDD00550)
OKDD00550	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL

SYCN Antibody
1-CSB-PA022989LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SYCN siRNA
20-abx905390	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYCN siRNA
20-abx935764	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYCN siRNA
20-abx935765	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SYCN
YF-PA23003	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SYCN

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human SYCN shRNA Plasmid
20-abx967407	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SYCN Recombinant Protein (Human)
RP043870	ABM	100 ug	Ask for price

SYCN cloning plasmid
CSB-CL022989HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 405 Sequence: ATGTCCCCGCTGCGCCCGCTGCTGCTGGCCCTGGCCCTTGCCTCCGTGCCTTGCGCCCAGGGCGCCTGCCCCGCCTCCGCCGACCTCAAGCACTCGGACGGGACGCGCACTTGCGCCAAGCTCTATGACAAGAGCGACCCCTACTATGAGAACTGCTGCGGGGGCGCCGAGCTGTC Show more
Description: A cloning plasmid for the SYCN gene.

SYCN Polyclonal Antibody
A63528	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SYCN ORF Vector (Human) (pORF)
ORF014624	ABM	1.0 ug DNA	EUR 354

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat SYCN shRNA Plasmid
20-abx987899	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SYCN shRNA Plasmid
20-abx976605	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SYCN Antibody, HRP conjugated
1-CSB-PA022989LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYCN Antibody, FITC conjugated
1-CSB-PA022989LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYCN Antibody, Biotin conjugated
1-CSB-PA022989LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SYCN Recombinant Protein (Rat)
RP231851	ABM	100 ug	Ask for price

SYCN Recombinant Protein (Mouse)
RP176684	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SYCN sgRNA CRISPR Lentivector set (Human)
K2318801	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9