Human SYCN(Syncollin) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Syncollin (SYCN) ELISA Kit |
RDR-SYCN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human SYCN(Syncollin) ELISA Kit |
EH3837 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q0VAF6
- Alias: SYCN/Syncollin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Syncollin (SYCN) ELISA Kit |
20-abx153204 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Syncollin (SYCN) ELISA Kit |
abx253231-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Syncollin (SYCN) ELISA Kit |
SED879Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syncollin (SYCN) ELISA Kit |
SED879Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syncollin (SYCN) ELISA Kit |
SED879Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syncollin (SYCN) ELISA Kit |
SED879Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncollin (SYCN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncollin (SYCN) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syncollin (SYCN) ELISA Kit |
4-SED879Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Syncollin elisa. Alternative names of the recognized antigen: SYL
- INSSA1
- Insulin Synthesis Associated 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncollin (SYCN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Syncollin (SYCN) Antibody |
20-abx131613 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Syncollin (SYCN) Antibody |
20-abx174694 |
Abbexa |
|
|
|
Syncollin (SYCN) Antibody |
20-abx305475 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Syncollin (SYCN) |
4-RPD879Hu01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q0VAF6
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Syncollin expressed in: E.coli |
Chicken Syncollin (SYCN) ELISA Kit |
abx354644-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Syncollin (SYCN) ELISA Kit |
abx354939-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Syncollin (SYCN) ELISA Kit |
abx355086-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Syncollin (SYCN) ELISA Kit |
abx355322-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Syncollin (Sycn) ELISA Kit |
abx390692-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Syncollin (Sycn) ELISA Kit |
abx392037-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human SYCN (Syncollin) |
ELK3086 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncollin (SYCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncollin (SYCN).
- Show more
|
Description: A sandwich ELISA kit for detection of Syncollin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human SYCN (Syncollin) |
E-EL-H1005 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SYCN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human Syncollin (SYCN) |
KTE60408-48T |
Abbkine |
48T |
EUR 332 |
- Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane.
Fu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syncollin (SYCN) |
KTE60408-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane.
Fu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syncollin (SYCN) |
KTE60408-96T |
Abbkine |
96T |
EUR 539 |
- Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane.
Fu
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syncollin (SYCN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Syncollin (SYCN) Protein |
20-abx650526 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Syncollin (SYCN) CLIA Kit |
20-abx494426 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Syncollin (SYCN) CLIA Kit |
abx197741-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Syncollin (SYCN) Antibody (HRP) |
20-abx305476 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Syncollin (SYCN) Antibody (FITC) |
20-abx305477 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Syncollin (SYCN) Antibody (Biotin) |
20-abx305478 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CLIA kit for Human SYCN (Syncollin) |
E-CL-H0677 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's SYCN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SYCN . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human SYCN (Syncollin) in samples from Serum, Plasma, Cell supernatant |
Syncollin (SYCN) Polyclonal Antibody (Human) |
4-PAD879Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN) |
Syncollin (SYCN) Polyclonal Antibody (Human), APC |
4-PAD879Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC. |
Syncollin (SYCN) Polyclonal Antibody (Human), Biotinylated |
4-PAD879Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Biotin. |
Syncollin (SYCN) Polyclonal Antibody (Human), Cy3 |
4-PAD879Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with Cy3. |
Syncollin (SYCN) Polyclonal Antibody (Human), FITC |
4-PAD879Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with FITC. |
Syncollin (SYCN) Polyclonal Antibody (Human), HRP |
4-PAD879Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with HRP. |
Syncollin (SYCN) Polyclonal Antibody (Human), PE |
4-PAD879Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with PE. |
Syncollin (SYCN) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD879Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SYCN (Cys38~Ser134)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Syncollin (SYCN). This antibody is labeled with APC-Cy7. |
SYCN ELISA Kit (Human) (OKCD08556) |
OKCD08556 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: SYCN functions in exocytosis in pancreatic acinar cells regulating the fusion of zymogen granules with each other. SYCN may have a pore-forming activity on membranes and regulate exocytosis in other exocrine tissues.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL |
SYCN ELISA Kit (Human) (OKDD00550) |
OKDD00550 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL |
SYCN siRNA |
20-abx905390 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYCN siRNA |
20-abx935764 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYCN siRNA |
20-abx935765 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SYCN Antibody |
1-CSB-PA022989LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
anti-SYCN |
YF-PA23003 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SYCN |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human SYCN shRNA Plasmid |
20-abx967407 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYCN Recombinant Protein (Human) |
RP043870 |
ABM |
100 ug |
Ask for price |
SYCN cloning plasmid |
CSB-CL022989HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 405
- Sequence: ATGTCCCCGCTGCGCCCGCTGCTGCTGGCCCTGGCCCTTGCCTCCGTGCCTTGCGCCCAGGGCGCCTGCCCCGCCTCCGCCGACCTCAAGCACTCGGACGGGACGCGCACTTGCGCCAAGCTCTATGACAAGAGCGACCCCTACTATGAGAACTGCTGCGGGGGCGCCGAGCTGTC
- Show more
|
Description: A cloning plasmid for the SYCN gene. |
SYCN Polyclonal Antibody |
A63528 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SYCN ORF Vector (Human) (pORF) |
ORF014624 |
ABM |
1.0 ug DNA |
EUR 354 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse SYCN shRNA Plasmid |
20-abx976605 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat SYCN shRNA Plasmid |
20-abx987899 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SYCN Antibody, HRP conjugated |
1-CSB-PA022989LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SYCN Antibody, FITC conjugated |
1-CSB-PA022989LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SYCN Antibody, Biotin conjugated |
1-CSB-PA022989LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SYCN. Recognizes SYCN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SYCN Recombinant Protein (Rat) |
RP231851 |
ABM |
100 ug |
Ask for price |
SYCN Recombinant Protein (Mouse) |
RP176684 |
ABM |
100 ug |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
SYCN sgRNA CRISPR Lentivector set (Human) |
K2318801 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|