Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RDR-TWSG1-Hu-48Tests 48 Tests
EUR 544
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RDR-TWSG1-Hu-96Tests 96 Tests
EUR 756
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RD-TWSG1-Hu-48Tests 48 Tests
EUR 521
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RD-TWSG1-Hu-96Tests 96 Tests
EUR 723
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
20-abx128102
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
20-abx174995
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
abx239120-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Twisted Gastrulation Protein Homolog 1 (TWSG1)
4-RPF862Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZX9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Twisted Gastrulation Protein Homolog 1 expressed in: E.coli
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT
ELI-28284h 96 Tests
EUR 824
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
20-abx153413
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1)ELISA Kit
201-12-2425 96 tests
EUR 440
  • This Twisted Gastrulation Protein Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
CSB-EL025361HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
1-CSB-EL025361HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E02014 96T
EUR 361
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
4-SEF862Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Twisted Gastrulation Protein Homolog 1 elisa. Alternative names of the recognized antigen: TSG
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) Protein
20-abx166022
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Twisted gastrulation protein homolog 1, Twsg1 ELISA KIT
ELI-23125m 96 Tests
EUR 865
Chicken Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT
ELI-44811c 96 Tests
EUR 928
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
CSB-EL025361MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
1-CSB-EL025361MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E10438 96T
EUR 361
Mouse Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E21552 96T
EUR 361
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) CLIA Kit
20-abx495028
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human TWSG1 (Twisted Gastrulation Protein Homolog 1)
ELK3568 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Twisted Gastrulation Protein Homolog 1 (TWSG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Twisted Gastrulation Protein Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-48T 48T
EUR 332
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-96T 96T
EUR 539
  • The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human)
4-PAF862Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1)
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC
4-PAF862Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Biotinylated
4-PAF862Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Biotin.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Cy3
4-PAF862Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Cy3.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), FITC
4-PAF862Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with FITC.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), HRP
4-PAF862Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with HRP.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), PE
4-PAF862Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with PE.
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC-Cy7
4-PAF862Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TWSG1 (Cys26~Phe223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC-Cy7.
Twisted Gastrulation, His, Human
HY-P7418 10ug
EUR 176
TSG Twisted Gastrulation Protein Human Recombinant Protein
PROTQ9GZX9 Regular: 50ug
EUR 317
Description: TWSG1 Human Recombinant (26-223) produced in CHO is a single, glycosylated, polypeptide chain containing 198 amino acids and having a molecular mass ranging from 35-43kDa on SDS-PAGE due to glycosylation.;The TWSG1 is purified by proprietary chromatographic techniques.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
TWSG1 ELISA KIT|Human
EF003957 96 Tests
EUR 689
TWSG1 ELISA Kit (Human) (OKCD00986)
OKCD00986 96 Wells
EUR 831
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL
Recombinant Human TWSG1 Protein
RP01049 10 μg
EUR 155
TWSG1 Recombinant Protein (Human)
RP033538 100 ug Ask for price
TWSG1 ELISA Kit (Mouse) (OKCA00932)
OKCA00932 96 Wells
EUR 833
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL
TWSG1 siRNA
20-abx938631
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TWSG1 siRNA
20-abx938632
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TWSG1 Antibody
42983-100ul 100ul
EUR 252
pENTR223- TWSG1
PVT11463 2 ug
EUR 273
anti-TWSG1
YF-PA26453 50 ul
EUR 334
Description: Mouse polyclonal to TWSG1
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
TWSG1 Recombinant Protein (Rat)
RP235358 100 ug Ask for price
TWSG1 Recombinant Protein (Mouse)
RP182351 100 ug Ask for price
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human TWSG1 shRNA Plasmid
20-abx961297
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Protein pellino homolog 1 ELISA kit
E01P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protein pellino homolog 1 ELISA kit
E01P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Protein pellino homolog 1 ELISA kit
E01P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
TWSG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2562802 1.0 ug DNA
EUR 154
TWSG1 Conjugated Antibody
C42983 100ul
EUR 397
anti- TWSG1 antibody
FNab09120 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: twisted gastrulation homolog 1
  • Uniprot ID: Q9GZX9
  • Gene ID: 57045
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TWSG1
TWSG1 cloning plasmid
CSB-CL863935HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtg
  • Show more
Description: A cloning plasmid for the TWSG1 gene.
Anti-TWSG1 antibody
PAab09120 100 ug
EUR 386
Anti-TWSG1 (6E6)
YF-MA19011 100 ug
EUR 363
Description: Mouse monoclonal to TWSG1
Anti-TWSG1 (2F3)
YF-MA19012 100 ug
EUR 363
Description: Mouse monoclonal to TWSG1
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.
Human DLK-1(Protein delta homolog 1 ) ELISA Kit
EH0575 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P80370
  • Alias: DLK-1/DLK1/FA1/PREF1/Pref-1/ZOG/pG2/delta-like 1 homolog(Drosophila)/DLK/fetal antigen 1/pG2delta-like homolog(Drosophila)/preadipocyte factor 1/protein delta homolog 1/secredeltin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Protein sel- 1 homolog 1, SEL1L ELISA KIT
ELI-30517h 96 Tests
EUR 824
Human Protein sel-1 homolog 1(SEL1L) ELISA kit
CSB-EL020973HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1 (SEL1L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Protein sel-1 homolog 1(SEL1L) ELISA kit
1-CSB-EL020973HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1(SEL1L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human Notch Homolog 1 ELISA kit
E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Notch Homolog 1 ELISA kit
E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Human Protein delta homolog 1 (DLK1) ELISA Kit
abx573388-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human ATOH1/ Protein atonal homolog 1 ELISA Kit
E0224Hu 1 Kit
EUR 605
Human seminal plasma protein homolog 1 ELISA kit
E01B0856-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human seminal plasma protein homolog 1 ELISA kit
E01B0856-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human seminal plasma protein homolog 1 ELISA kit
E01B0856-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human DLK1/ Protein delta homolog 1 ELISA Kit
E0703Hu 1 Kit
EUR 537
Human ATOH1(Protein atonal homolog 1) ELISA Kit
EH0804 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q92858
  • Alias: ATOH1(Protein atonal homolog 1)/ATH1/Class A basic helix-loop-helix protein 14(bHLHa14)/Helix-loop-helix protein hATH-1(hATH1)/BHLHA14
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml
Human Protein canopy homolog 1, CNPY1 ELISA KIT
ELI-10076h 96 Tests
EUR 824
Human Protein chibby homolog 1, CBY1 ELISA KIT
ELI-10764h 96 Tests
EUR 824
Human Protein angel homolog 1, ANGEL1 ELISA KIT
ELI-11501h 96 Tests
EUR 824
Human Protein patched homolog 1, PTCH1 ELISA KIT
ELI-14033h 96 Tests
EUR 824
Human Protein spire homolog 1, SPIRE1 ELISA KIT
ELI-18268h 96 Tests
EUR 824
Human Slit homolog 1 protein, SLIT1 ELISA KIT
ELI-18717h 96 Tests
EUR 824
Human Protein Smaug homolog 1, SAMD4A ELISA KIT
ELI-18721h 96 Tests
EUR 824
Human Protein flightless- 1 homolog, FLII ELISA KIT
ELI-20816h 96 Tests
EUR 824
Human Protein Hook homolog 1, HOOK1 ELISA KIT
ELI-20843h 96 Tests
EUR 824
Human Protein zer- 1 homolog, ZER1 ELISA KIT
ELI-21849h 96 Tests
EUR 824
Human Protein misato homolog 1, MSTO1 ELISA KIT
ELI-23224h 96 Tests
EUR 824
Human Notchless protein homolog 1, NLE1 ELISA KIT
ELI-23640h 96 Tests
EUR 824
Human Protein DDI1 homolog 1, DDI1 ELISA KIT
ELI-26365h 96 Tests
EUR 824
Human Protein delta homolog 1, DLK1 ELISA KIT
ELI-03465h 96 Tests
EUR 824
Human Protein tweety homolog 1, TTYH1 ELISA KIT
ELI-17044h 96 Tests
EUR 824
Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT
ELI-08272h 96 Tests
EUR 824
Human Protein asteroid homolog 1, ASTE1 ELISA KIT
ELI-34777h 96 Tests
EUR 824
Human Protein PAT1 homolog 1, PATL1 ELISA KIT
ELI-35756h 96 Tests
EUR 824
Human Protein NipSnap homolog 1, NIPSNAP1 ELISA KIT
ELI-36966h 96 Tests
EUR 824
Human Protein HEG homolog 1, HEG1 ELISA KIT
ELI-43926h 96 Tests
EUR 824
Human Protein spinster homolog 1, SPNS1 ELISA KIT
ELI-30037h 96 Tests
EUR 824
Human Protein dispatched homolog 1, DISP1 ELISA KIT
ELI-31941h 96 Tests
EUR 824
Human Protein slowmo homolog 1, SLMO1 ELISA KIT
ELI-41003h 96 Tests
EUR 824
Human Protein sprouty homolog 1, SPRY1 ELISA KIT
ELI-41452h 96 Tests
EUR 824
Human Protein salvador homolog 1, SAV1 ELISA KIT
ELI-42110h 96 Tests
EUR 824
Human Homer protein homolog 1, HOMER1 ELISA KIT
ELI-48682h 96 Tests
EUR 824
Human Chromobox protein homolog 1, CBX1 ELISA KIT
ELI-49038h 96 Tests
EUR 824
Human PMS1 protein homolog 1, PMS1 ELISA KIT
ELI-38092h 96 Tests
EUR 824
Human Protein jagunal homolog 1, JAGN1 ELISA KIT
ELI-38160h 96 Tests
EUR 824
Human Protein patched homolog 1 (PTCH1) ELISA Kit
abx382549-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein zer-1 homolog (ZER1) ELISA Kit
abx384392-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein misato homolog 1 (MSTO1) ELISA Kit
abx385159-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein salvador homolog 1 (SAV1) ELISA Kit
abx385382-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein Chibby Homolog 1 (CBY1) ELISA Kit
20-abx386320
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Protein DDI1 Homolog 1 (DDI1) ELISA Kit
abx386823-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein dispatched homolog 1 (DISP1) ELISA Kit
abx386894-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein Atonal Homolog 1 (ATOH1) ELISA Kit
abx253762-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Protein Hook Homolog 1 (HOOK1) ELISA Kit
abx387850-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein patched homolog 1(PTCH1) ELISA kit
CSB-EL018956HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1 (PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Protein patched homolog 1(PTCH1) ELISA kit
1-CSB-EL018956HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1(PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Protein delta homolog 1(DLK1) ELISA kit
CSB-EL006945HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1 (DLK1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Protein delta homolog 1(DLK1) ELISA kit
1-CSB-EL006945HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1(DLK1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Homer protein homolog 1(HOMER1)ELISA Kit
QY-E05396 96T
EUR 361
TWSG1 ORF Vector (Human) (pORF)
ORF011180 1.0 ug DNA
EUR 95
TWSG1 Protein Vector (Human) (pPB-C-His)
PV044717 500 ng
EUR 329
TWSG1 Protein Vector (Human) (pPB-N-His)
PV044718 500 ng
EUR 329
TWSG1 Protein Vector (Human) (pPM-C-HA)
PV044719 500 ng
EUR 329
TWSG1 Protein Vector (Human) (pPM-C-His)
PV044720 500 ng
EUR 329
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1 96 Well Plate
EUR 417
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Rat Protein pellino homolog 1 ELISA kit
E02P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Protein pellino homolog 1 ELISA kit
E02P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Protein pellino homolog 1 ELISA kit
E02P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Protein pellino homolog 1 ELISA kit
E03P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Protein pellino homolog 1 ELISA kit
E06P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Protein pellino homolog 1 ELISA kit
E06P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Protein pellino homolog 1 ELISA kit
E06P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Protein pellino homolog 1 ELISA kit
E07P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Protein pellino homolog 1 ELISA kit
E07P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Protein pellino homolog 1 ELISA kit
E07P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Protein pellino homolog 1 ELISA kit
E08P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Protein pellino homolog 1 ELISA kit
E08P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Protein pellino homolog 1 ELISA kit
E08P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Protein pellino homolog 1 ELISA kit
E09P0173-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Protein pellino homolog 1 ELISA kit
E09P0173-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Protein pellino homolog 1 ELISA kit
E09P0173-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1 96 Well Plate
EUR 417
Human Complexin-1 AssayMax ELISA Kit
EC3505-1 96 Well Plate
EUR 417
Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1 96 Well Plate
EUR 477
PTEN Human, Phosphatase and Tensin homolog Human Recombinant Protein, His Tag
PROTP60484-1 Regular: 5ug
EUR 317
Description: PTEN Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 423 amino acids (1- 403 a.a.) and having a molecular mass of 49.3kDa.;The PTEN is purified by proprietary chromatographic techniques.
Mouse TWSG1 shRNA Plasmid
20-abx975346
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pECMV-3-FLAG-TWSG1
PVT13364 2 ug
EUR 599
Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Protein fem-1 homolog A
EK4646 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein fem-1 homolog A in samples from serum, plasma, tissue homogenates and other biological fluids.
Human FEM1A/ Protein fem-1 homolog A ELISA Kit
E0888Hu 1 Kit
EUR 605
Human PER1( Period circadian protein homolog 1) ELISA Kit
EH11018 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
Human FEM1A(Protein fem-1 homolog A) ELISA Kit
EH2300 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9BSK4
  • Alias: FEM1A/FEM1a/FEM1-alpha/Prostaglandin E receptor 4-associated protein/FEM1A/EPRAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Protein sel- 1 homolog 2, SEL1L2 ELISA KIT
ELI-19187h 96 Tests
EUR 824
Human Periodic tryptophan protein 1 homolog, PWP1 ELISA KIT
ELI-22135h 96 Tests
EUR 824
Human Protein bicaudal C homolog 1, BICC1 ELISA KIT
ELI-25173h 96 Tests
EUR 824
Human Protein fem- 1 homolog A, FEM1A ELISA KIT
ELI-26673h 96 Tests
EUR 824
Human Period circadian protein homolog 1, PER1 ELISA KIT
ELI-16042h 96 Tests
EUR 824
Human Zinc finger protein 1 homolog, ZFP1 ELISA KIT
ELI-17605h 96 Tests
EUR 824
Human GrpE protein homolog 1, mitochondrial, GRPEL1 ELISA KIT
ELI-27959h 96 Tests
EUR 824
Human Protein phosphatase Slingshot homolog 1, SSH1 ELISA KIT
ELI-52686h 96 Tests
EUR 824
Human Protein sel- 1 homolog 3, SEL1L3 ELISA KIT
ELI-53219h 96 Tests
EUR 824
Human Protein strawberry notch homolog 1, SBNO1 ELISA KIT
ELI-35945h 96 Tests
EUR 824
Human Grainyhead- like protein 1 homolog, GRHL1 ELISA KIT
ELI-42866h 96 Tests
EUR 824
Human Protein fem- 1 homolog B, FEM1B ELISA KIT
ELI-43930h 96 Tests
EUR 824
Human Protein naked cuticle homolog 1, NKD1 ELISA KIT
ELI-46165h 96 Tests
EUR 824
Human Dead end protein homolog 1, DND1 ELISA KIT
ELI-47098h 96 Tests
EUR 824
Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT
ELI-28406h 96 Tests
EUR 824
Human WAS protein family homolog 1, WASH1 ELISA KIT
ELI-28757h 96 Tests
EUR 824
Human Protein limb expression 1 homolog, LIX1 ELISA KIT
ELI-31673h 96 Tests
EUR 824
Human Protein fem- 1 homolog C, FEM1C ELISA KIT
ELI-48472h 96 Tests
EUR 824
Human Protein bicaudal D homolog 1, BICD1 ELISA KIT
ELI-49976h 96 Tests
EUR 824
Human Protein dpy- 19 homolog 1, DPY19L1 ELISA KIT
ELI-50641h 96 Tests
EUR 824
Human Limb region 1 protein homolog, LMBR1 ELISA KIT
ELI-38064h 96 Tests
EUR 824
Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit
abx384020-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit
abx385018-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Protein fem-1 homolog A (FEM1A) ELISA Kit
abx251652-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human GrpE Protein Homolog 1, Mitochondrial (GRPEL1) ELISA Kit
abx387682-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-48T 48T
EUR 332
  • The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-96T 96T
EUR 539
  • The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-48T 48T
EUR 332
  • PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-96T 96T
EUR 539
  • PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-48T 48T
EUR 332
  • DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
  • it is also thought to be a tumor suppressor. It is one of several imprint
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
  • it is also thought to be a tumor suppressor. It is one of several imprint
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-96T 96T
EUR 539
  • DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
  • it is also thought to be a tumor suppressor. It is one of several imprint
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-48T 48T
EUR 332
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-96T 96T
EUR 539
  • The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-48T 48T
EUR 332
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-96T 96T
EUR 539
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-48T 48T
EUR 332
  • SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-96T 96T
EUR 539
  • SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Human Dachshund Homolog 1 (DACH1) ELISA Kit
abx556324-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.
Human Roundabout homolog 1 (ROBO1) ELISA Kit
abx556329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx571378-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx576304-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu 1 Kit
EUR 605
Human Achaete scute homolog 1 ELISA kit
E01A0079-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Achaete scute homolog 1 ELISA kit
E01A0079-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Disabled homolog 1
EK3039 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Roundabout homolog 1
EK4583 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Ovostatin homolog 1
EK5036 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human OVOS1/ Ovostatin homolog 1 ELISA Kit
E1844Hu 1 Kit
EUR 605
Human ROBO1/ Roundabout homolog 1 ELISA Kit
E2165Hu 1 Kit
EUR 605
Human DAB1(Disabled homolog 1) ELISA Kit
EH1419 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: O75553
  • Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human OVOS1(Ovostatin homolog 1) ELISA Kit
EH2509 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q6IE37
  • Alias: OVOS1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
Human Nanos homolog 1, NANOS1 ELISA KIT
ELI-20656h 96 Tests
EUR 824
Human Dapper homolog 1, DACT1 ELISA KIT
ELI-26384h 96 Tests
EUR 824
Human Disabled homolog 1, DAB1 ELISA KIT
ELI-04118h 96 Tests
EUR 824