Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RDR-TWSG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RDR-TWSG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RD-TWSG1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
RD-TWSG1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
20-abx128102	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
20-abx174995	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody
abx239120-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Twisted Gastrulation Protein Homolog 1 (TWSG1)
4-RPF862Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9GZX9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Twisted Gastrulation Protein Homolog 1 expressed in: E.coli

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E01T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT
ELI-28284h	Lifescience Market	96 Tests	EUR 824

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
20-abx153413	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1)ELISA Kit
201-12-2425	SunredBio	96 tests	EUR 440
This Twisted Gastrulation Protein Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
CSB-EL025361HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
1-CSB-EL025361HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E02014	Qayee Biotechnology	96T	EUR 361

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
SEF862Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% In Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit
4-SEF862Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Twisted Gastrulation Protein Homolog 1 elisa. Alternative names of the recognized antigen: TSG
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) Protein
20-abx166022	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E03T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E02T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E04T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E08T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E07T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E06T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E09T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Twisted gastrulation protein homolog 1, Twsg1 ELISA KIT
ELI-23125m	Lifescience Market	96 Tests	EUR 865

Chicken Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT
ELI-44811c	Lifescience Market	96 Tests	EUR 928

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
CSB-EL025361MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
1-CSB-EL025361MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E10438	Qayee Biotechnology	96T	EUR 361

Mouse Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit
QY-E21552	Qayee Biotechnology	96T	EUR 361

Human Twisted Gastrulation Protein Homolog 1 (TWSG1) CLIA Kit
20-abx495028	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TWSG1 (Twisted Gastrulation Protein Homolog 1)
ELK3568	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Twisted Gastrulation Protein Homolog 1 (TWSG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody Show more
Description: A sandwich ELISA kit for detection of Twisted Gastrulation Protein Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-48T	Abbkine	48T	EUR 332
The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2 Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2 Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1)
KTE60114-96T	Abbkine	96T	EUR 539
The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2 Show more
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human)
4-PAF862Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1)

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit
E05T0745-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC
4-PAF862Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Biotinylated
4-PAF862Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Biotin.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Cy3
4-PAF862Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Cy3.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), FITC
4-PAF862Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with FITC.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), HRP
4-PAF862Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with HRP.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), PE
4-PAF862Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with PE.

Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC-Cy7
4-PAF862Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TWSG1 (Cys26~Phe223) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC-Cy7.

Twisted Gastrulation, His, Human
HY-P7418	MedChemExpress	10ug	EUR 176

TSG Twisted Gastrulation Protein Human Recombinant Protein
PROTQ9GZX9	BosterBio	Regular: 50ug	EUR 317
Description: TWSG1 Human Recombinant (26-223) produced in CHO is a single, glycosylated, polypeptide chain containing 198 amino acids and having a molecular mass ranging from 35-43kDa on SDS-PAGE due to glycosylation.;The TWSG1 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TWSG1 ELISA KIT|Human
EF003957	Lifescience Market	96 Tests	EUR 689

TWSG1 ELISA Kit (Human) (OKCD00986)
OKCD00986	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL

Recombinant Human TWSG1 Protein
RP01049	Abclonal	10 μg	EUR 155

TWSG1 Recombinant Protein (Human)
RP033538	ABM	100 ug	Ask for price

TWSG1 ELISA Kit (Mouse) (OKCA00932)
OKCA00932	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

TWSG1 siRNA
20-abx938631	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TWSG1 siRNA
20-abx938632	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TWSG1 Antibody
42983-100ul	SAB	100ul	EUR 252

pENTR223- TWSG1
PVT11463	Lifescience Market	2 ug	EUR 273

anti-TWSG1
YF-PA26453	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TWSG1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

TWSG1 Recombinant Protein (Rat)
RP235358	ABM	100 ug	Ask for price

TWSG1 Recombinant Protein (Mouse)
RP182351	ABM	100 ug	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human TWSG1 shRNA Plasmid
20-abx961297	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Protein pellino homolog 1 ELISA kit
E01P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TWSG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2562802	ABM	1.0 ug DNA	EUR 154

TWSG1 Conjugated Antibody
C42983	SAB	100ul	EUR 397

anti- TWSG1 antibody
FNab09120	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: twisted gastrulation homolog 1 Uniprot ID: Q9GZX9 Gene ID: 57045 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against TWSG1

TWSG1 cloning plasmid
CSB-CL863935HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 672 Sequence: atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtg Show more
Description: A cloning plasmid for the TWSG1 gene.

Anti-TWSG1 antibody
PAab09120	Lifescience Market	100 ug	EUR 386

Anti-TWSG1 (6E6)
YF-MA19011	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TWSG1

Anti-TWSG1 (2F3)
YF-MA19012	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TWSG1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human DLK-1(Protein delta homolog 1 ) ELISA Kit
EH0575	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P80370 Alias: DLK-1/DLK1/FA1/PREF1/Pref-1/ZOG/pG2/delta-like 1 homolog(Drosophila)/DLK/fetal antigen 1/pG2delta-like homolog(Drosophila)/preadipocyte factor 1/protein delta homolog 1/secredeltin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protein sel- 1 homolog 1, SEL1L ELISA KIT
ELI-30517h	Lifescience Market	96 Tests	EUR 824

Human Protein sel-1 homolog 1(SEL1L) ELISA kit
CSB-EL020973HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1 (SEL1L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein sel-1 homolog 1(SEL1L) ELISA kit
1-CSB-EL020973HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1(SEL1L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit
E01N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Human Protein delta homolog 1 (DLK1) ELISA Kit
abx573388-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ATOH1/ Protein atonal homolog 1 ELISA Kit
E0224Hu	Sunlong	1 Kit	EUR 605

Human seminal plasma protein homolog 1 ELISA kit
E01B0856-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1 ELISA kit
E01B0856-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1 ELISA kit
E01B0856-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chromobox protein homolog 1(CBX1) ELISA kit
E01C1420-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DLK1/ Protein delta homolog 1 ELISA Kit
E0703Hu	Sunlong	1 Kit	EUR 537

Human ATOH1(Protein atonal homolog 1) ELISA Kit
EH0804	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q92858 Alias: ATOH1(Protein atonal homolog 1)/ATH1/Class A basic helix-loop-helix protein 14(bHLHa14)/Helix-loop-helix protein hATH-1(hATH1)/BHLHA14
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Protein canopy homolog 1, CNPY1 ELISA KIT
ELI-10076h	Lifescience Market	96 Tests	EUR 824

Human Protein chibby homolog 1, CBY1 ELISA KIT
ELI-10764h	Lifescience Market	96 Tests	EUR 824

Human Protein angel homolog 1, ANGEL1 ELISA KIT
ELI-11501h	Lifescience Market	96 Tests	EUR 824

Human Protein patched homolog 1, PTCH1 ELISA KIT
ELI-14033h	Lifescience Market	96 Tests	EUR 824

Human Protein spire homolog 1, SPIRE1 ELISA KIT
ELI-18268h	Lifescience Market	96 Tests	EUR 824

Human Slit homolog 1 protein, SLIT1 ELISA KIT
ELI-18717h	Lifescience Market	96 Tests	EUR 824

Human Protein Smaug homolog 1, SAMD4A ELISA KIT
ELI-18721h	Lifescience Market	96 Tests	EUR 824

Human Protein flightless- 1 homolog, FLII ELISA KIT
ELI-20816h	Lifescience Market	96 Tests	EUR 824

Human Protein Hook homolog 1, HOOK1 ELISA KIT
ELI-20843h	Lifescience Market	96 Tests	EUR 824

Human Protein zer- 1 homolog, ZER1 ELISA KIT
ELI-21849h	Lifescience Market	96 Tests	EUR 824

Human Protein misato homolog 1, MSTO1 ELISA KIT
ELI-23224h	Lifescience Market	96 Tests	EUR 824

Human Notchless protein homolog 1, NLE1 ELISA KIT
ELI-23640h	Lifescience Market	96 Tests	EUR 824

Human Protein DDI1 homolog 1, DDI1 ELISA KIT
ELI-26365h	Lifescience Market	96 Tests	EUR 824

Human Protein delta homolog 1, DLK1 ELISA KIT
ELI-03465h	Lifescience Market	96 Tests	EUR 824

Human Protein tweety homolog 1, TTYH1 ELISA KIT
ELI-17044h	Lifescience Market	96 Tests	EUR 824

Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT
ELI-08272h	Lifescience Market	96 Tests	EUR 824

Human Protein asteroid homolog 1, ASTE1 ELISA KIT
ELI-34777h	Lifescience Market	96 Tests	EUR 824

Human Protein PAT1 homolog 1, PATL1 ELISA KIT
ELI-35756h	Lifescience Market	96 Tests	EUR 824

Human Protein NipSnap homolog 1, NIPSNAP1 ELISA KIT
ELI-36966h	Lifescience Market	96 Tests	EUR 824

Human Protein HEG homolog 1, HEG1 ELISA KIT
ELI-43926h	Lifescience Market	96 Tests	EUR 824

Human Protein spinster homolog 1, SPNS1 ELISA KIT
ELI-30037h	Lifescience Market	96 Tests	EUR 824

Human Protein dispatched homolog 1, DISP1 ELISA KIT
ELI-31941h	Lifescience Market	96 Tests	EUR 824

Human Protein slowmo homolog 1, SLMO1 ELISA KIT
ELI-41003h	Lifescience Market	96 Tests	EUR 824

Human Protein sprouty homolog 1, SPRY1 ELISA KIT
ELI-41452h	Lifescience Market	96 Tests	EUR 824

Human Protein salvador homolog 1, SAV1 ELISA KIT
ELI-42110h	Lifescience Market	96 Tests	EUR 824

Human Homer protein homolog 1, HOMER1 ELISA KIT
ELI-48682h	Lifescience Market	96 Tests	EUR 824

Human Chromobox protein homolog 1, CBX1 ELISA KIT
ELI-49038h	Lifescience Market	96 Tests	EUR 824

Human PMS1 protein homolog 1, PMS1 ELISA KIT
ELI-38092h	Lifescience Market	96 Tests	EUR 824

Human Protein jagunal homolog 1, JAGN1 ELISA KIT
ELI-38160h	Lifescience Market	96 Tests	EUR 824

Human Protein patched homolog 1 (PTCH1) ELISA Kit
abx382549-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein zer-1 homolog (ZER1) ELISA Kit
abx384392-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein misato homolog 1 (MSTO1) ELISA Kit
abx385159-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein salvador homolog 1 (SAV1) ELISA Kit
abx385382-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein Chibby Homolog 1 (CBY1) ELISA Kit
20-abx386320	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Protein DDI1 Homolog 1 (DDI1) ELISA Kit
abx386823-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein dispatched homolog 1 (DISP1) ELISA Kit
abx386894-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein Atonal Homolog 1 (ATOH1) ELISA Kit
abx253762-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Protein Hook Homolog 1 (HOOK1) ELISA Kit
abx387850-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein patched homolog 1(PTCH1) ELISA kit
CSB-EL018956HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1 (PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein patched homolog 1(PTCH1) ELISA kit
1-CSB-EL018956HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1(PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protein delta homolog 1(DLK1) ELISA kit
CSB-EL006945HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1 (DLK1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein delta homolog 1(DLK1) ELISA kit
1-CSB-EL006945HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1(DLK1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Homer protein homolog 1(HOMER1)ELISA Kit
QY-E05396	Qayee Biotechnology	96T	EUR 361

TWSG1 ORF Vector (Human) (pORF)
ORF011180	ABM	1.0 ug DNA	EUR 95

TWSG1 Protein Vector (Human) (pPB-C-His)
PV044717	ABM	500 ng	EUR 329

TWSG1 Protein Vector (Human) (pPB-N-His)
PV044718	ABM	500 ng	EUR 329

TWSG1 Protein Vector (Human) (pPM-C-HA)
PV044719	ABM	500 ng	EUR 329

TWSG1 Protein Vector (Human) (pPM-C-His)
PV044720	ABM	500 ng	EUR 329

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit
EH5215-1	AssayPro	96 Well Plate	EUR 417

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein pellino homolog 1 ELISA kit
E02P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein pellino homolog 1 ELISA kit
E03P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein pellino homolog 1 ELISA kit
E04P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit
E06P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit
E06P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein pellino homolog 1 ELISA kit
E06P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit
E07P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit
E07P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein pellino homolog 1 ELISA kit
E07P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit
E08P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit
E08P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein pellino homolog 1 ELISA kit
E08P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit
E09P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit
E09P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein pellino homolog 1 ELISA kit
E09P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

PTEN Human, Phosphatase and Tensin homolog Human Recombinant Protein, His Tag
PROTP60484-1	BosterBio	Regular: 5ug	EUR 317
Description: PTEN Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 423 amino acids (1- 403 a.a.) and having a molecular mass of 49.3kDa.;The PTEN is purified by proprietary chromatographic techniques.

Mouse TWSG1 shRNA Plasmid
20-abx975346	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pECMV-3-FLAG-TWSG1
PVT13364	Lifescience Market	2 ug	EUR 599

Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human WAS protein family homolog 1(WASH1) ELISA kit
E01W0003-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human seminal plasma protein homolog 1(BSPH1) ELISA kit
E01S0303-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Protein fem-1 homolog A
EK4646	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein fem-1 homolog A in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FEM1A/ Protein fem-1 homolog A ELISA Kit
E0888Hu	Sunlong	1 Kit	EUR 605

Human PER1( Period circadian protein homolog 1) ELISA Kit
EH11018	FN Test	96T	EUR 567.6
Detection range: 15.625-1000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human FEM1A(Protein fem-1 homolog A) ELISA Kit
EH2300	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q9BSK4 Alias: FEM1A/FEM1a/FEM1-alpha/Prostaglandin E receptor 4-associated protein/FEM1A/EPRAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protein sel- 1 homolog 2, SEL1L2 ELISA KIT
ELI-19187h	Lifescience Market	96 Tests	EUR 824

Human Periodic tryptophan protein 1 homolog, PWP1 ELISA KIT
ELI-22135h	Lifescience Market	96 Tests	EUR 824

Human Protein bicaudal C homolog 1, BICC1 ELISA KIT
ELI-25173h	Lifescience Market	96 Tests	EUR 824

Human Protein fem- 1 homolog A, FEM1A ELISA KIT
ELI-26673h	Lifescience Market	96 Tests	EUR 824

Human Period circadian protein homolog 1, PER1 ELISA KIT
ELI-16042h	Lifescience Market	96 Tests	EUR 824

Human Zinc finger protein 1 homolog, ZFP1 ELISA KIT
ELI-17605h	Lifescience Market	96 Tests	EUR 824

Human GrpE protein homolog 1, mitochondrial, GRPEL1 ELISA KIT
ELI-27959h	Lifescience Market	96 Tests	EUR 824

Human Protein phosphatase Slingshot homolog 1, SSH1 ELISA KIT
ELI-52686h	Lifescience Market	96 Tests	EUR 824

Human Protein sel- 1 homolog 3, SEL1L3 ELISA KIT
ELI-53219h	Lifescience Market	96 Tests	EUR 824

Human Protein strawberry notch homolog 1, SBNO1 ELISA KIT
ELI-35945h	Lifescience Market	96 Tests	EUR 824

Human Grainyhead- like protein 1 homolog, GRHL1 ELISA KIT
ELI-42866h	Lifescience Market	96 Tests	EUR 824

Human Protein fem- 1 homolog B, FEM1B ELISA KIT
ELI-43930h	Lifescience Market	96 Tests	EUR 824

Human Protein naked cuticle homolog 1, NKD1 ELISA KIT
ELI-46165h	Lifescience Market	96 Tests	EUR 824

Human Dead end protein homolog 1, DND1 ELISA KIT
ELI-47098h	Lifescience Market	96 Tests	EUR 824

Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT
ELI-28406h	Lifescience Market	96 Tests	EUR 824

Human WAS protein family homolog 1, WASH1 ELISA KIT
ELI-28757h	Lifescience Market	96 Tests	EUR 824

Human Protein limb expression 1 homolog, LIX1 ELISA KIT
ELI-31673h	Lifescience Market	96 Tests	EUR 824

Human Protein fem- 1 homolog C, FEM1C ELISA KIT
ELI-48472h	Lifescience Market	96 Tests	EUR 824

Human Protein bicaudal D homolog 1, BICD1 ELISA KIT
ELI-49976h	Lifescience Market	96 Tests	EUR 824

Human Protein dpy- 19 homolog 1, DPY19L1 ELISA KIT
ELI-50641h	Lifescience Market	96 Tests	EUR 824

Human Limb region 1 protein homolog, LMBR1 ELISA KIT
ELI-38064h	Lifescience Market	96 Tests	EUR 824

Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit
abx384020-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit
abx385018-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein fem-1 homolog A (FEM1A) ELISA Kit
abx251652-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human GrpE Protein Homolog 1, Mitochondrial (GRPEL1) ELISA Kit
abx387682-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-48T	Abbkine	48T	EUR 332
The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Slit homolog 1 protein (SLIT1)
KTE60582-96T	Abbkine	96T	EUR 539
The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain Show more
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-48T	Abbkine	48T	EUR 332
PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein patched homolog 1 (PTCH1)
KTE61075-96T	Abbkine	96T	EUR 539
PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor. Mutati Show more
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-48T	Abbkine	48T	EUR 332
DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes it is also thought to be a tumor suppressor. It is one of several imprint Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes it is also thought to be a tumor suppressor. It is one of several imprint Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein delta homolog 1 (DLK1)
KTE62020-96T	Abbkine	96T	EUR 539
DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes it is also thought to be a tumor suppressor. It is one of several imprint Show more
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-48T	Abbkine	48T	EUR 332
The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein dispatched homolog 1 (DISP1)
KTE62045-96T	Abbkine	96T	EUR 539
The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in Show more
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-48T	Abbkine	48T	EUR 332
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-96T	Abbkine	96T	EUR 539
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-48T	Abbkine	48T	EUR 332
SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein spinster homolog 1 (SPNS1)
KTE60330-96T	Abbkine	96T	EUR 539
SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r Show more
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Dachshund Homolog 1 (DACH1) ELISA Kit
abx556324-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Human Roundabout homolog 1 (ROBO1) ELISA Kit
abx556329-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx571378-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx576304-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu	Sunlong	1 Kit	EUR 605

Human Achaete scute homolog 1 ELISA kit
E01A0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Achaete scute homolog 1 ELISA kit
E01A0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Disabled homolog 1
EK3039	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Roundabout homolog 1
EK4583	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Ovostatin homolog 1
EK5036	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS1/ Ovostatin homolog 1 ELISA Kit
E1844Hu	Sunlong	1 Kit	EUR 605

Human ROBO1/ Roundabout homolog 1 ELISA Kit
E2165Hu	Sunlong	1 Kit	EUR 605

Human DAB1(Disabled homolog 1) ELISA Kit
EH1419	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: O75553 Alias: DAB1/Disabled homolog 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human OVOS1(Ovostatin homolog 1) ELISA Kit
EH2509	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q6IE37 Alias: OVOS1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Nanos homolog 1, NANOS1 ELISA KIT
ELI-20656h	Lifescience Market	96 Tests	EUR 824

Human Dapper homolog 1, DACT1 ELISA KIT
ELI-26384h	Lifescience Market	96 Tests	EUR 824

Human Disabled homolog 1, DAB1 ELISA KIT
ELI-04118h	Lifescience Market	96 Tests	EUR 824