Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RDR-TWSG1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RDR-TWSG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RD-TWSG1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RD-TWSG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
20-abx128102 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
20-abx174995 |
Abbexa |
|
|
|
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
abx239120-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Twisted Gastrulation Protein Homolog 1 (TWSG1) |
4-RPF862Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9GZX9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Twisted Gastrulation Protein Homolog 1 expressed in: E.coli |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT |
ELI-28284h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
20-abx153413 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Twisted Gastrulation Protein Homolog 1 (TWSG1)ELISA Kit |
201-12-2425 |
SunredBio |
96 tests |
EUR 440 |
- This Twisted Gastrulation Protein Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
CSB-EL025361HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
1-CSB-EL025361HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E02014 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
4-SEF862Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Twisted Gastrulation Protein Homolog 1 elisa. Alternative names of the recognized antigen: TSG
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) Protein |
20-abx166022 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1, Twsg1 ELISA KIT |
ELI-23125m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT |
ELI-44811c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
CSB-EL025361MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
1-CSB-EL025361MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E10438 |
Qayee Biotechnology |
96T |
EUR 361 |
Mouse Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E21552 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) CLIA Kit |
20-abx495028 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TWSG1 (Twisted Gastrulation Protein Homolog 1) |
ELK3568 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Twisted Gastrulation Protein Homolog 1 (TWSG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
- Show more
|
Description: A sandwich ELISA kit for detection of Twisted Gastrulation Protein Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-48T |
Abbkine |
48T |
EUR 332 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-96T |
Abbkine |
96T |
EUR 539 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human) |
4-PAF862Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1) |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC |
4-PAF862Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Biotinylated |
4-PAF862Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Biotin. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Cy3 |
4-PAF862Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Cy3. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), FITC |
4-PAF862Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with FITC. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), HRP |
4-PAF862Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with HRP. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), PE |
4-PAF862Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with PE. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF862Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC-Cy7. |
TSG Twisted Gastrulation Protein Human Recombinant Protein |
PROTQ9GZX9 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: TWSG1 Human Recombinant (26-223) produced in CHO is a single, glycosylated, polypeptide chain containing 198 amino acids and having a molecular mass ranging from 35-43kDa on SDS-PAGE due to glycosylation.;The TWSG1 is purified by proprietary chromatographic techniques. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TWSG1 ELISA Kit (Human) (OKCD00986) |
OKCD00986 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL |
Recombinant Human TWSG1 Protein |
RP01049 |
Abclonal |
10 μg |
EUR 155 |
TWSG1 Recombinant Protein (Human) |
RP033538 |
ABM |
100 ug |
Ask for price |
TWSG1 ELISA Kit (Mouse) (OKCA00932) |
OKCA00932 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
TWSG1 siRNA |
20-abx938631 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TWSG1 siRNA |
20-abx938632 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TWSG1 Antibody |
42983-100ul |
SAB |
100ul |
EUR 252 |
anti-TWSG1 |
YF-PA26453 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TWSG1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
TWSG1 Recombinant Protein (Rat) |
RP235358 |
ABM |
100 ug |
Ask for price |
TWSG1 Recombinant Protein (Mouse) |
RP182351 |
ABM |
100 ug |
Ask for price |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human TWSG1 shRNA Plasmid |
20-abx961297 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Protein pellino homolog 1 ELISA kit |
E01P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein pellino homolog 1 ELISA kit |
E01P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein pellino homolog 1 ELISA kit |
E01P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TWSG1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2562802 |
ABM |
1.0 ug DNA |
EUR 154 |
TWSG1 Conjugated Antibody |
C42983 |
SAB |
100ul |
EUR 397 |
anti- TWSG1 antibody |
FNab09120 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: twisted gastrulation homolog 1
- Uniprot ID: Q9GZX9
- Gene ID: 57045
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against TWSG1 |
TWSG1 cloning plasmid |
CSB-CL863935HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 672
- Sequence: atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtg
- Show more
|
Description: A cloning plasmid for the TWSG1 gene. |
Anti-TWSG1 (6E6) |
YF-MA19011 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TWSG1 |
Anti-TWSG1 (2F3) |
YF-MA19012 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TWSG1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Human DLK-1(Protein delta homolog 1 ) ELISA Kit |
EH0575 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P80370
- Alias: DLK-1/DLK1/FA1/PREF1/Pref-1/ZOG/pG2/delta-like 1 homolog(Drosophila)/DLK/fetal antigen 1/pG2delta-like homolog(Drosophila)/preadipocyte factor 1/protein delta homolog 1/secredeltin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Protein sel- 1 homolog 1, SEL1L ELISA KIT |
ELI-30517h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein sel-1 homolog 1(SEL1L) ELISA kit |
CSB-EL020973HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1 (SEL1L) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein sel-1 homolog 1(SEL1L) ELISA kit |
1-CSB-EL020973HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein sel-1 homolog 1(SEL1L) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human Notch Homolog 1 ELISA kit |
E01N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Human Protein delta homolog 1 (DLK1) ELISA Kit |
abx573388-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human ATOH1/ Protein atonal homolog 1 ELISA Kit |
E0224Hu |
Sunlong |
1 Kit |
EUR 605 |
Human seminal plasma protein homolog 1 ELISA kit |
E01B0856-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human seminal plasma protein homolog 1 ELISA kit |
E01B0856-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human seminal plasma protein homolog 1 ELISA kit |
E01B0856-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chromobox protein homolog 1(CBX1) ELISA kit |
E01C1420-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chromobox protein homolog 1(CBX1) ELISA kit |
E01C1420-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Chromobox protein homolog 1(CBX1) ELISA kit |
E01C1420-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 1(CBX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DLK1/ Protein delta homolog 1 ELISA Kit |
E0703Hu |
Sunlong |
1 Kit |
EUR 537 |
Human ATOH1(Protein atonal homolog 1) ELISA Kit |
EH0804 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: Q92858
- Alias: ATOH1(Protein atonal homolog 1)/ATH1/Class A basic helix-loop-helix protein 14(bHLHa14)/Helix-loop-helix protein hATH-1(hATH1)/BHLHA14
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human Protein canopy homolog 1, CNPY1 ELISA KIT |
ELI-10076h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein chibby homolog 1, CBY1 ELISA KIT |
ELI-10764h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein angel homolog 1, ANGEL1 ELISA KIT |
ELI-11501h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein patched homolog 1, PTCH1 ELISA KIT |
ELI-14033h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein spire homolog 1, SPIRE1 ELISA KIT |
ELI-18268h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Slit homolog 1 protein, SLIT1 ELISA KIT |
ELI-18717h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein Smaug homolog 1, SAMD4A ELISA KIT |
ELI-18721h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein flightless- 1 homolog, FLII ELISA KIT |
ELI-20816h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein Hook homolog 1, HOOK1 ELISA KIT |
ELI-20843h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein zer- 1 homolog, ZER1 ELISA KIT |
ELI-21849h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein misato homolog 1, MSTO1 ELISA KIT |
ELI-23224h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Notchless protein homolog 1, NLE1 ELISA KIT |
ELI-23640h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein DDI1 homolog 1, DDI1 ELISA KIT |
ELI-26365h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein delta homolog 1, DLK1 ELISA KIT |
ELI-03465h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein tweety homolog 1, TTYH1 ELISA KIT |
ELI-17044h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT |
ELI-08272h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein asteroid homolog 1, ASTE1 ELISA KIT |
ELI-34777h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein PAT1 homolog 1, PATL1 ELISA KIT |
ELI-35756h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein NipSnap homolog 1, NIPSNAP1 ELISA KIT |
ELI-36966h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein HEG homolog 1, HEG1 ELISA KIT |
ELI-43926h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein spinster homolog 1, SPNS1 ELISA KIT |
ELI-30037h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein dispatched homolog 1, DISP1 ELISA KIT |
ELI-31941h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein slowmo homolog 1, SLMO1 ELISA KIT |
ELI-41003h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein sprouty homolog 1, SPRY1 ELISA KIT |
ELI-41452h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein salvador homolog 1, SAV1 ELISA KIT |
ELI-42110h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Homer protein homolog 1, HOMER1 ELISA KIT |
ELI-48682h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Chromobox protein homolog 1, CBX1 ELISA KIT |
ELI-49038h |
Lifescience Market |
96 Tests |
EUR 824 |
Human PMS1 protein homolog 1, PMS1 ELISA KIT |
ELI-38092h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein jagunal homolog 1, JAGN1 ELISA KIT |
ELI-38160h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein patched homolog 1 (PTCH1) ELISA Kit |
abx382549-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein zer-1 homolog (ZER1) ELISA Kit |
abx384392-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein misato homolog 1 (MSTO1) ELISA Kit |
abx385159-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein salvador homolog 1 (SAV1) ELISA Kit |
abx385382-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein Chibby Homolog 1 (CBY1) ELISA Kit |
20-abx386320 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human Protein DDI1 Homolog 1 (DDI1) ELISA Kit |
abx386823-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein dispatched homolog 1 (DISP1) ELISA Kit |
abx386894-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein Atonal Homolog 1 (ATOH1) ELISA Kit |
abx253762-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Protein Hook Homolog 1 (HOOK1) ELISA Kit |
abx387850-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein patched homolog 1(PTCH1) ELISA kit |
CSB-EL018956HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1 (PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein patched homolog 1(PTCH1) ELISA kit |
1-CSB-EL018956HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein patched homolog 1(PTCH1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Protein delta homolog 1(DLK1) ELISA kit |
CSB-EL006945HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1 (DLK1) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein delta homolog 1(DLK1) ELISA kit |
1-CSB-EL006945HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein delta homolog 1(DLK1) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
TWSG1 ORF Vector (Human) (pORF) |
ORF011180 |
ABM |
1.0 ug DNA |
EUR 95 |
TWSG1 Protein Vector (Human) (pPB-C-His) |
PV044717 |
ABM |
500 ng |
EUR 329 |
TWSG1 Protein Vector (Human) (pPB-N-His) |
PV044718 |
ABM |
500 ng |
EUR 329 |
TWSG1 Protein Vector (Human) (pPM-C-HA) |
PV044719 |
ABM |
500 ng |
EUR 329 |
TWSG1 Protein Vector (Human) (pPM-C-His) |
PV044720 |
ABM |
500 ng |
EUR 329 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit |
EH5215-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein pellino homolog 1 ELISA kit |
E02P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein pellino homolog 1 ELISA kit |
E03P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein pellino homolog 1 ELISA kit |
E04P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein pellino homolog 1 ELISA kit |
E04P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein pellino homolog 1 ELISA kit |
E04P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein pellino homolog 1 ELISA kit |
E06P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein pellino homolog 1 ELISA kit |
E06P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein pellino homolog 1 ELISA kit |
E06P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein pellino homolog 1 ELISA kit |
E07P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein pellino homolog 1 ELISA kit |
E07P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein pellino homolog 1 ELISA kit |
E07P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein pellino homolog 1 ELISA kit |
E08P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein pellino homolog 1 ELISA kit |
E08P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein pellino homolog 1 ELISA kit |
E08P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein pellino homolog 1 ELISA kit |
E09P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein pellino homolog 1 ELISA kit |
E09P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein pellino homolog 1 ELISA kit |
E09P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PTEN Human, Phosphatase and Tensin homolog Human Recombinant Protein, His Tag |
PROTP60484-1 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: PTEN Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 423 amino acids (1- 403 a.a.) and having a molecular mass of 49.3kDa.;The PTEN is purified by proprietary chromatographic techniques. |
Mouse TWSG1 shRNA Plasmid |
20-abx975346 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human WAS protein family homolog 1(WASH1) ELISA kit |
E01W0003-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human WAS protein family homolog 1(WASH1) ELISA kit |
E01W0003-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human WAS protein family homolog 1(WASH1) ELISA kit |
E01W0003-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human WAS protein family homolog 1(WASH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human seminal plasma protein homolog 1(BSPH1) ELISA kit |
E01S0303-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human seminal plasma protein homolog 1(BSPH1) ELISA kit |
E01S0303-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human seminal plasma protein homolog 1(BSPH1) ELISA kit |
E01S0303-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human seminal plasma protein homolog 1(BSPH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Protein fem-1 homolog A |
EK4646 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein fem-1 homolog A in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human FEM1A/ Protein fem-1 homolog A ELISA Kit |
E0888Hu |
Sunlong |
1 Kit |
EUR 605 |
Human PER1( Period circadian protein homolog 1) ELISA Kit |
EH11018 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.625-1000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human FEM1A(Protein fem-1 homolog A) ELISA Kit |
EH2300 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q9BSK4
- Alias: FEM1A/FEM1a/FEM1-alpha/Prostaglandin E receptor 4-associated protein/FEM1A/EPRAP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Protein sel- 1 homolog 2, SEL1L2 ELISA KIT |
ELI-19187h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Periodic tryptophan protein 1 homolog, PWP1 ELISA KIT |
ELI-22135h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein bicaudal C homolog 1, BICC1 ELISA KIT |
ELI-25173h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein fem- 1 homolog A, FEM1A ELISA KIT |
ELI-26673h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Period circadian protein homolog 1, PER1 ELISA KIT |
ELI-16042h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Zinc finger protein 1 homolog, ZFP1 ELISA KIT |
ELI-17605h |
Lifescience Market |
96 Tests |
EUR 824 |
Human GrpE protein homolog 1, mitochondrial, GRPEL1 ELISA KIT |
ELI-27959h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein phosphatase Slingshot homolog 1, SSH1 ELISA KIT |
ELI-52686h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein sel- 1 homolog 3, SEL1L3 ELISA KIT |
ELI-53219h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein strawberry notch homolog 1, SBNO1 ELISA KIT |
ELI-35945h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Grainyhead- like protein 1 homolog, GRHL1 ELISA KIT |
ELI-42866h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein fem- 1 homolog B, FEM1B ELISA KIT |
ELI-43930h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein naked cuticle homolog 1, NKD1 ELISA KIT |
ELI-46165h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Dead end protein homolog 1, DND1 ELISA KIT |
ELI-47098h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TEL2- interacting protein 1 homolog, TTI1 ELISA KIT |
ELI-28406h |
Lifescience Market |
96 Tests |
EUR 824 |
Human WAS protein family homolog 1, WASH1 ELISA KIT |
ELI-28757h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein limb expression 1 homolog, LIX1 ELISA KIT |
ELI-31673h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein fem- 1 homolog C, FEM1C ELISA KIT |
ELI-48472h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein bicaudal D homolog 1, BICD1 ELISA KIT |
ELI-49976h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protein dpy- 19 homolog 1, DPY19L1 ELISA KIT |
ELI-50641h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Limb region 1 protein homolog, LMBR1 ELISA KIT |
ELI-38064h |
Lifescience Market |
96 Tests |
EUR 824 |
Human TELO2-Interacting Protein 1 Homolog (TTI1) ELISA Kit |
abx384020-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Hydrolethalus Syndrome Protein 1 Homolog (HYLS1) ELISA Kit |
abx385018-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein fem-1 homolog A (FEM1A) ELISA Kit |
abx251652-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human GrpE Protein Homolog 1, Mitochondrial (GRPEL1) ELISA Kit |
abx387682-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Slit homolog 1 protein (SLIT1) |
KTE60582-48T |
Abbkine |
48T |
EUR 332 |
- The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Slit homolog 1 protein (SLIT1) |
KTE60582-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Slit homolog 1 protein (SLIT1) |
KTE60582-96T |
Abbkine |
96T |
EUR 539 |
- The SLIT1 cDNA encodes a 1,534-amino acid polypeptide with 43.5% similarity to the Drosophila 'slit' protein. Northern blot analysis revealed that the human SLIT1 gene was expressed as a major 8.4- and a minor 5.9-kb transcript primarily in the brain
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Slit homolog 1 protein (SLIT1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein patched homolog 1 (PTCH1) |
KTE61075-48T |
Abbkine |
48T |
EUR 332 |
- PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor.
Mutati
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein patched homolog 1 (PTCH1) |
KTE61075-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor.
Mutati
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein patched homolog 1 (PTCH1) |
KTE61075-96T |
Abbkine |
96T |
EUR 539 |
- PTCH1 encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis. This gene functions as a tumor suppressor.
Mutati
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein patched homolog 1 (PTCH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein delta homolog 1 (DLK1) |
KTE62020-48T |
Abbkine |
48T |
EUR 332 |
- DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
- it is also thought to be a tumor suppressor. It is one of several imprint
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein delta homolog 1 (DLK1) |
KTE62020-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
- it is also thought to be a tumor suppressor. It is one of several imprint
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein delta homolog 1 (DLK1) |
KTE62020-96T |
Abbkine |
96T |
EUR 539 |
- DLK1 encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes
- it is also thought to be a tumor suppressor. It is one of several imprint
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein delta homolog 1 (DLK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein dispatched homolog 1 (DISP1) |
KTE62045-48T |
Abbkine |
48T |
EUR 332 |
- The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein dispatched homolog 1 (DISP1) |
KTE62045-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein dispatched homolog 1 (DISP1) |
KTE62045-96T |
Abbkine |
96T |
EUR 539 |
- The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein dispatched homolog 1 (DISP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-48T |
Abbkine |
48T |
EUR 332 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-96T |
Abbkine |
96T |
EUR 539 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein spinster homolog 1 (SPNS1) |
KTE60330-48T |
Abbkine |
48T |
EUR 332 |
- SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein spinster homolog 1 (SPNS1) |
KTE60330-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein spinster homolog 1 (SPNS1) |
KTE60330-96T |
Abbkine |
96T |
EUR 539 |
- SPIN1 played a critical role in necrotic cell death in cultured human cells. SPIN1 bound the antiapoptotic protein BCL2 and the apoptosis regulator BCLXL and induced cell death via a pathway that was independent of mitochondrial cytochrome c (CYCS) r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein spinster homolog 1 (SPNS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Dachshund Homolog 1 (DACH1) ELISA Kit |
abx556324-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Human Roundabout homolog 1 (ROBO1) ELISA Kit |
abx556329-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Frizzled Homolog 1 (FZD1) ELISA Kit |
abx571378-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dickkopf 1 Homolog (DKK1) ELISA Kit |
abx576304-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human DAB1/ Disabled homolog 1 ELISA Kit |
E0654Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Achaete scute homolog 1 ELISA kit |
E01A0079-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Achaete scute homolog 1 ELISA kit |
E01A0079-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crumbs homolog 1(CRB1) ELISA kit |
E01C2038-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crumbs homolog 1(CRB1) ELISA kit |
E01C2038-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crumbs homolog 1(CRB1) ELISA kit |
E01C2038-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Disabled homolog 1 |
EK3039 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Roundabout homolog 1 |
EK4583 |
SAB |
96 tests |
EUR 603 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Ovostatin homolog 1 |
EK5036 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human OVOS1/ Ovostatin homolog 1 ELISA Kit |
E1844Hu |
Sunlong |
1 Kit |
EUR 605 |
Human ROBO1/ Roundabout homolog 1 ELISA Kit |
E2165Hu |
Sunlong |
1 Kit |
EUR 605 |
Human DAB1(Disabled homolog 1) ELISA Kit |
EH1419 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: O75553
- Alias: DAB1/Disabled homolog 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human OVOS1(Ovostatin homolog 1) ELISA Kit |
EH2509 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 15.6-1000 pg/ml
- Uniprot ID: Q6IE37
- Alias: OVOS1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |