Human CACYBP(Calcyclin Binding Protein) ELISA Kit

Human CACYBP(Calcyclin Binding Protein) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Calcyclin Binding Protein (CACYBP) ELISA Kit
RD-CACYBP-Hu-96Tests 96 Tests
EUR 723
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
20-abx150888
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
abx576391-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Calcyclin- binding protein, CACYBP ELISA KIT
ELI-32854h 96 Tests
EUR 824
Human Calcyclin Binding Protein(CACYBP)ELISA Kit
QY-E03466 96T
EUR 394
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
SEC353Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calcyclin Binding Protein (CACYBP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calcyclin Binding Protein (CACYBP) in Tissue homogenates, cell lysates and other biological fluids.
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
SEC353Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calcyclin Binding Protein (CACYBP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calcyclin Binding Protein (CACYBP) in Tissue homogenates, cell lysates and other biological fluids.
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
SEC353Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calcyclin Binding Protein (CACYBP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calcyclin Binding Protein (CACYBP) in Tissue homogenates, cell lysates and other biological fluids.
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
SEC353Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Calcyclin Binding Protein (CACYBP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Calcyclin Binding Protein (CACYBP) in Tissue homogenates, cell lysates and other biological fluids.
Human Calcyclin Binding Protein (CACYBP) ELISA Kit
4-SEC353Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Calcyclin Binding Protein elisa. Alternative names of the recognized antigen: SIP
  • GIG5
  • PNAS-107
  • RP1-102G20.6
  • S100A6BP
  • S100A6-binding protein
  • Siah-interacting protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Calcyclin Binding Protein (CACYBP) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Calcyclin Binding Protein (CACYBP) Protein
20-abx165974
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx111318
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx123562
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx128972
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx171520
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx338842
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody
20-abx327443
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody
abx231182-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Calcyclin Binding Protein (CACYBP)
4-RPC353Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HB71
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calcyclin Binding Protein expressed in: E.coli
Mouse Calcyclin Binding Protein (CACYBP) ELISA Kit
abx255233-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Calcyclin- binding protein, Cacybp ELISA KIT
ELI-09012m 96 Tests
EUR 865
Monkey Calcyclin Binding Protein (CACYBP) ELISA Kit
abx360306-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Calcyclin Binding Protein (CACYBP) ELISA Kit
abx362027-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Calcyclin Binding Protein (CACYBP) ELISA Kit
abx363313-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Calcyclin Binding Protein (CACYBP) ELISA Kit
abx391062-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Calcyclin Binding Protein (CACYBP) ELISA Kit
abx356832-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse CACYBP(Calcyclin Binding Protein) ELISA Kit
EM0893 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q9CXW3
  • Alias: CACYBP/CacyBP/Siah-interacting protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml
Bovine Calcyclin- binding protein, CACYBP ELISA KIT
ELI-50605b 96 Tests
EUR 928
Human Calcyclin Binding Protein (CACYBP) CLIA Kit
abx196495-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Calcyclin Binding Protein (CACYBP) CLIA Kit
20-abx493639
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human CACYBP (Calcyclin Binding Protein)
E-EL-H0622 1 plate of 96 wells
EUR 534
  • Gentaur's CACYBP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CACYBP. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CACYBP (Calcyclin Binding Protein) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human CACYBP (Calcyclin Binding Protein)
ELK3169 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Calcyclin Binding Protein (CACYBP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Calcyclin Binding Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
CACYBP Calcyclin Binding Protein Human Recombinant Protein
PROTQ9HB71 Regular: 25ug
EUR 317
Description: CACYBP Human Recombinant produced in E.Coli is a single, non-glycosylated,_x000D_ polypeptide chain containing 205 amino acids (1-185a.a.) and having a molecular mass of 23.4 kDa. CACYBP protein is fused to a 20 amino acid His tag at N-terminus and is purified by standard chromatography.
Calcyclin Binding Protein (CACYBP) Antibody (HRP)
20-abx334935
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody (FITC)
20-abx334936
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Calcyclin Binding Protein (CACYBP) Antibody (Biotin)
20-abx334937
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Mouse CACYBP (Calcyclin Binding Protein)
E-EL-M0220 1 plate of 96 wells
EUR 534
  • Gentaur's CACYBP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CACYBP. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CACYBP (Calcyclin Binding Protein) in samples from Serum, Plasma, Cell supernatant
Mouse Calcyclin Binding Protein (CACYBP) CLIA Kit
abx196769-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Cacybp ELISA Kit| Rat Calcyclin-binding protein ELISA Kit
EF018415 96 Tests
EUR 689
CACYBP ELISA Kit| Bovine Calcyclin-binding protein ELISA Kit
EF011187 96 Tests
EUR 689
CACYBP ELISA Kit| Mouse Calcyclin Binding Protein ELISA Kit
EF013484 96 Tests
EUR 689
CLIA kit for Human CACYBP (Calcyclin Binding Protein)
E-CL-H0476 1 plate of 96 wells
EUR 584
  • Gentaur's CACYBP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CACYBP . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CACYBP (Calcyclin Binding Protein) in samples from Serum, Plasma, Cell supernatant
CLIA kit for Mouse CACYBP (Calcyclin Binding Protein)
E-CL-M0159 1 plate of 96 wells
EUR 584
  • Gentaur's CACYBP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse CACYBP . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse CACYBP (Calcyclin Binding Protein) in samples from Serum, Plasma, Cell supernatant
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig)
4-PAC353Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP)
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), APC
4-PAC353Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with APC.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC353Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with Biotin.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), Cy3
4-PAC353Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with Cy3.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), FITC
4-PAC353Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with FITC.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), HRP
4-PAC353Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with HRP.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), PE
4-PAC353Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with PE.
Calcyclin Binding Protein (CACYBP) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC353Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CACYBP (Ala2~Phe228)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Calcyclin Binding Protein (CACYBP). This antibody is labeled with APC-Cy7.
Human Calcyclin Binding Protein ELISA kit
E01C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Calcyclin Binding Protein ELISA kit
E01C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Calcyclin Binding Protein ELISA kit
E01C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Calcyclin Binding Protein
20-abx260601
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Goat Calcyclin Binding Protein ELISA kit
E06C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Calcyclin Binding Protein ELISA kit
E06C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Calcyclin Binding Protein ELISA kit
E06C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Calcyclin Binding Protein ELISA kit
E03C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Calcyclin Binding Protein ELISA kit
E03C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Calcyclin Binding Protein ELISA kit
E03C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Calcyclin Binding Protein ELISA kit
E04C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Calcyclin Binding Protein ELISA kit
E04C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Calcyclin Binding Protein ELISA kit
E04C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Calcyclin Binding Protein ELISA kit
E02C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Calcyclin Binding Protein ELISA kit
E02C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Calcyclin Binding Protein ELISA kit
E02C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Calcyclin Binding Protein ELISA kit
E09C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Calcyclin Binding Protein ELISA kit
E09C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Calcyclin Binding Protein ELISA kit
E09C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Calcyclin Binding Protein ELISA kit
E08C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Calcyclin Binding Protein ELISA kit
E08C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Calcyclin Binding Protein ELISA kit
E08C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Calcyclin Binding Protein ELISA kit
E07C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Calcyclin Binding Protein ELISA kit
E07C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Calcyclin Binding Protein ELISA kit
E07C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Recombinant Human Calcyclin Binding Protein
7-04597 5µg Ask for price
Recombinant Human Calcyclin Binding Protein
7-04598 25µg Ask for price
Recombinant Human Calcyclin Binding Protein
7-04599 1mg Ask for price
Guinea pig Calcyclin Binding Protein ELISA kit
E05C0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Calcyclin Binding Protein ELISA kit
E05C0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Calcyclin Binding Protein ELISA kit
E05C0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Calcyclin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cacybp/ Rat Cacybp ELISA Kit
ELI-07856r 96 Tests
EUR 886
Human CACYBP ELISA Kit
EHC0547 96Tests
EUR 521
CACYBP ELISA KIT|Human
EF008331 96 Tests
EUR 689
CACYBP ELISA Kit (Human) (OKCD01203)
OKCD01203 96 Wells
EUR 831
Description: Description of target: May be involved in calcium-dependent ubiquitination and subsequent proteasomal degradation of target proteins. Probably serves as a molecular bridge in ubiquitin E3 complexes. Participates in the ubiquitin-mediated degradation of beta-catenin (CTNNB1).1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.22"Structural analysis of Siah1-Siah-interacting protein interactions and insights into the assembly of an E3 ligase multiprotein complex."_x005F_x005F_x000D_Santelli E., Leone M., Li C., Fukushima T., Preece N.E., Olson A.J., Ely K.R., Reed J.C., Pellecchia M., Liddington R.C., Matsuzawa S._x005F_x005F_x000D_J. Biol. Chem. 280:34278-34287(2005) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.2 ANGSTROMS) OF 1-70, SUBUNIT, MUTAGENESIS OF 23-LYS--ARG-26; VAL-64 AND PRO-66, FUNCTION, INTERACTION WITH SIAH1. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 33 pg/mL
Goat CACYBP ELISA Kit
EGTC0547 96Tests
EUR 521
Bovine CACYBP ELISA Kit
EBC0547 96Tests
EUR 521
Canine CACYBP ELISA Kit
ECC0547 96Tests
EUR 521
Chicken CACYBP ELISA Kit
ECKC0547 96Tests
EUR 521
Anserini CACYBP ELISA Kit
EAC0547 96Tests
EUR 521
Mouse CACYBP ELISA Kit
EMC0547 96Tests
EUR 521
Rat CACYBP ELISA Kit
ERC0547 96Tests
EUR 521
Sheep CACYBP ELISA Kit
ESC0547 96Tests
EUR 521
Rabbit CACYBP ELISA Kit
ERTC0547 96Tests
EUR 521
Monkey CACYBP ELISA Kit
EMKC0547 96Tests
EUR 521
Porcine CACYBP ELISA Kit
EPC0547 96Tests
EUR 521
CACYBP Recombinant Protein (Human)
RP050410 100 ug Ask for price
Guinea Pig CACYBP ELISA Kit
EGC0547 96Tests
EUR 521
CACYBP ELISA Kit (Mouse) (OKWB00245)
OKWB00245 96 Wells
EUR 572
Description: Description of target: May be involved in calcium-dependent ubiquitination and subsequent proteasomal degradation of target proteins. Probably serves as a molecular bridge in ubiquitin E3 complexes. Participates in the ubiquitin-mediated degradation of beta-catenin (CTNNB1) ;Species reactivity: Mouse;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL
Calcyclin antibody
10R-1913 100 ul
EUR 349
Description: Mouse monoclonal Calcyclin antibody
Calcyclin Antibody
abx015725-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
CacyBP antibody
22712-100ul 100ul
EUR 390
CACYBP antibody
70R-16121 50 ul
EUR 435
Description: Rabbit polyclonal CACYBP antibody
CACYBP antibody
70R-1064 100 ug
EUR 377
Description: Rabbit polyclonal CACYBP antibody raised against the middle region of CACYBP
CacyBP antibody
70R-13651 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CacyBP antibody
CACYBP antibody
10R-1396 100 ug
EUR 512
Description: Mouse monoclonal CACYBP antibody
CACYBP antibody
10R-11287 50 ug
EUR 349
Description: Mouse monoclonal anti human CACYBP antibody
CACYBP Antibody
1-CSB-PA004423GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CACYBP Antibody
1-CSB-PA005625
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
CACYBP Antibody
1-CSB-PA872536LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
CACYBP siRNA
20-abx900739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CACYBP siRNA
20-abx910113
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CACYBP siRNA
20-abx910114
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CACYBP protein (His tag)
80R-1330 100 ug
EUR 268
Description: Purified recombinant Human CACYBP protein
CACYBP Recombinant Protein (Rat)
RP192857 100 ug Ask for price
CACYBP Recombinant Protein (Mouse)
RP120728 100 ug Ask for price
anti-Calcyclin (7D11)
LF-MA30045 100 ul
EUR 445
Description: Mouse Monoclonal to Calcyclin
Anti-Calcyclin antibody
STJ97890 100 µl
EUR 234
Description: Mouse monoclonal to Calcyclin.
Human CACYBP shRNA Plasmid
20-abx958964
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CACYBP Blocking Peptide
33R-3089 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CACYBP antibody, catalog no. 70R-1064
CacyBP Polyclonal Antibody
41775-100ul 100ul
EUR 252
CacyBP Polyclonal Antibody
41775-50ul 50ul
EUR 187
CACYBP cloning plasmid
CSB-CL872536HU-10ug 10ug
EUR 301
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atggcttcagaagagctacagaaagatctagaagaggtaaaggtgttgctggaaaaggctactaggaaaagagtacgtgatgcccttacagctgaaaaatccaagattgagacagaaatcaagaacaagatgcaacagaaatcacagaagaaagcagaacttcttgataatgaaaa
  • Show more
Description: A cloning plasmid for the CACYBP gene.
CacyBP Polyclonal Antibody
ABP53120-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CacyBP
  • Applications tips:
Description: A polyclonal antibody for detection of CacyBP from Human, Mouse, Rat. This CacyBP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CacyBP
CacyBP Polyclonal Antibody
ABP53120-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CacyBP
  • Applications tips:
Description: A polyclonal antibody for detection of CacyBP from Human, Mouse, Rat. This CacyBP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CacyBP
CacyBP Polyclonal Antibody
ABP53120-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CacyBP
  • Applications tips:
Description: A polyclonal antibody for detection of CacyBP from Human, Mouse, Rat. This CacyBP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CacyBP
CACYBP Rabbit pAb
A8757-100ul 100 ul
EUR 308
CACYBP Rabbit pAb
A8757-200ul 200 ul
EUR 459
CACYBP Rabbit pAb
A8757-20ul 20 ul
EUR 183
CACYBP Rabbit pAb
A8757-50ul 50 ul
EUR 223
CacyBP Polyclonal Antibody
ES4119-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CacyBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CacyBP Polyclonal Antibody
ES4119-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CacyBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
anti- CACYBP antibody
FNab01182 100µg
EUR 505.25
  • Immunogen: calcyclin binding protein
  • Uniprot ID: Q9HB71
  • Gene ID: 27101
  • Research Area: Metabolism
Description: Antibody raised against CACYBP
Anti-CACYBP antibody
PAab01182 100 ug
EUR 355
pSV40- Cacybp- m
PVT11633 2 ug
EUR 273
Anti-CACYBP antibody
STJ11100880 100 µl
EUR 413
Description: The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-CACYBP antibody
STJ111403 100 µl
EUR 277
Description: The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-CacyBP antibody
STJ96754 200 µl
EUR 197
Description: Rabbit polyclonal to CacyBP.
CACYBP ORF Vector (Human) (pORF)
ORF016804 1.0 ug DNA
EUR 405
CACYBP Protein Vector (Human) (pPB-C-His)
PV067213 500 ng
EUR 552
CACYBP Protein Vector (Human) (pPB-N-His)
PV067214 500 ng
EUR 552
CACYBP Protein Vector (Human) (pPM-C-HA)
PV067215 500 ng
EUR 552
CACYBP Protein Vector (Human) (pPM-C-His)
PV067216 500 ng
EUR 552
Recombinant Human CACYBP Protein, His, E.coli-1mg
QP11253-1mg 1mg
EUR 2312
Recombinant Human CACYBP Protein, His, E.coli-25ug
QP11253-25ug 25ug
EUR 201
Recombinant Human CACYBP Protein, His, E.coli-5ug
QP11253-5ug 5ug
EUR 155
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Anti-SIAH Interacting Protein/CACYBP Antibody
PA1759 100ug/vial
EUR 334
Anti-SIAH Interacting Protein/CACYBP Antibody
RP1104 100ug/vial
EUR 334
CACYBP Antibody, HRP conjugated
1-CSB-PA872536LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CACYBP Antibody, FITC conjugated
1-CSB-PA872536LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CACYBP Antibody, Biotin conjugated
1-CSB-PA872536LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CACYBP. Recognizes CACYBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Rat CACYBP shRNA Plasmid
20-abx988368
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CacyBP Polyclonal Conjugated Antibody
C41775 100ul
EUR 397
Mouse CACYBP shRNA Plasmid
20-abx969433
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal Calcyclin Antibody, Clone: 7D11
AMM02612G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Calcyclin. The antibodies are raised in Mouse and are from clone 7D11. This antibody is applicable in WB and IHC, E
CACYBP sgRNA CRISPR Lentivector set (Human)
K0353201 3 x 1.0 ug
EUR 339
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Human Retinol Binding Protein ELISA Kit
E-80RBP 1 x 96 well plate
EUR 370
Human Androgen binding protein ELISA kit
E01A0021-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Androgen binding protein ELISA kit
E01A0021-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Heparin binding protein ELISA kit
E01H0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Heparin binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Heparin binding protein ELISA kit
E01H0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Heparin binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Heparin binding protein ELISA kit
E01H0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Heparin binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0217-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0217-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0217-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0317-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0317-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Hyaluronate binding protein ELISA kit
E01H0317-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hyaluronate binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Harpin Binding Protein ELISA kit
E01H0319-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Harpin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Harpin Binding Protein ELISA kit
E01H0319-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Harpin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Harpin Binding Protein ELISA kit
E01H0319-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Harpin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Inhibin Binding Protein ELISA kit
E01I0104-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Inhibin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Inhibin Binding Protein ELISA kit
E01I0104-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Inhibin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Inhibin Binding Protein ELISA kit
E01I0104-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Inhibin Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lipolysaccharide binding protein ELISA kit
E01L0209-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipolysaccharide binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lipolysaccharide binding protein ELISA kit
E01L0209-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipolysaccharide binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lipolysaccharide binding protein ELISA kit
E01L0209-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lipolysaccharide binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prostatic binding protein ELISA kit
E01P0616-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostatic binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prostatic binding protein ELISA kit
E01P0616-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostatic binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Prostatic binding protein ELISA kit
E01P0616-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Prostatic binding protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinol Binding Protein ELISA kit
E01R0006-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinol Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinol Binding Protein ELISA kit
E01R0006-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinol Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Retinol Binding Protein ELISA kit
E01R0006-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Retinol Binding Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human cortisol binding protein ELISA kit 
QY-E05314 96T
EUR 374
Human DBP/DNA Binding Protein(DNA Binding Protein) ELISA Kit
EH2936 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q10586
  • Alias: DBP/DNA Binding Protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Human Mannma binding protein/mannan binding lectin ELISA kit
E01M0240-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mannma binding protein/mannan binding lectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mannma binding protein/mannan binding lectin ELISA kit
E01M0240-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mannma binding protein/mannan binding lectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mannma binding protein/mannan binding lectin ELISA kit
E01M0240-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mannma binding protein/mannan binding lectin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
CACYBP Protein Vector (Mouse) (pPB-C-His)
PV160974 500 ng
EUR 603
CACYBP Protein Vector (Mouse) (pPB-N-His)
PV160975 500 ng
EUR 603
CACYBP Protein Vector (Mouse) (pPM-C-HA)
PV160976 500 ng
EUR 603
CACYBP Protein Vector (Mouse) (pPM-C-His)
PV160977 500 ng
EUR 603
CACYBP Protein Vector (Rat) (pPB-C-His)
PV257146 500 ng
EUR 603
CACYBP Protein Vector (Rat) (pPB-N-His)
PV257147 500 ng
EUR 603
CACYBP Protein Vector (Rat) (pPM-C-HA)
PV257148 500 ng
EUR 603
CACYBP Protein Vector (Rat) (pPM-C-His)
PV257149 500 ng
EUR 603
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Polyclonal CACYBP antibody - middle region
AMM05674G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CACYBP - middle region. This antibody is tested and proven to work in the following applications:
[KO Validated] CACYBP Rabbit pAb
A20004-100ul 100 ul
EUR 410
[KO Validated] CACYBP Rabbit pAb
A20004-200ul 200 ul
EUR 571
[KO Validated] CACYBP Rabbit pAb
A20004-20ul 20 ul
EUR 221
[KO Validated] CACYBP Rabbit pAb
A20004-50ul 50 ul
EUR 287
Cacybp ORF Vector (Rat) (pORF)
ORF064287 1.0 ug DNA
EUR 506
Cacybp ORF Vector (Mouse) (pORF)
ORF040244 1.0 ug DNA
EUR 506
CACYBP sgRNA CRISPR Lentivector (Human) (Target 1)
K0353202 1.0 ug DNA
EUR 154
CACYBP sgRNA CRISPR Lentivector (Human) (Target 2)
K0353203 1.0 ug DNA
EUR 154
CACYBP sgRNA CRISPR Lentivector (Human) (Target 3)
K0353204 1.0 ug DNA
EUR 154
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Human Mannose Binding Lectin/Mannan Binding Protein (MBL2) ELISA Kit
20-abx152283
  • EUR 5515.00
  • EUR 2947.00
  • EUR 692.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Mannose Binding Lectin/Mannan Binding Protein (MBL2) ELISA Kit
abx253415-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human lipolysaccharide binding protein,LBP ELISA Kit
201-12-0361 96 tests
EUR 440
  • This lipolysaccharide binding protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human C4 binding protein,C4BP ELISA Kit
201-12-0389 96 tests
EUR 440
  • This C4 binding protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human DNA Binding Protein,DBP ELISA Kit
201-12-0636 96 tests
EUR 440
  • This DNA Binding Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Traf2 binding protein,T2BP ELISA Kit
201-12-0652 96 tests
EUR 440
  • This Traf2 binding protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Androgen Binding Protein,ABP ELISA Kit
201-12-0996 96 tests
EUR 440
  • This Androgen Binding Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Retinol binding protein,RBP ELISA Kit
201-12-1199 96 tests
EUR 440
  • This Retinol binding protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human CD27 Binding Protein (CD27BP) ELISA Kit
DLR-CD27BP-Hu-48T 48T
EUR 554
  • Should the Human CD27 Binding Protein (CD27BP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD27 Binding Protein (CD27BP) in samples from tissue homogenates or other biological fluids.
Human CD27 Binding Protein (CD27BP) ELISA Kit
DLR-CD27BP-Hu-96T 96T
EUR 725
  • Should the Human CD27 Binding Protein (CD27BP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CD27 Binding Protein (CD27BP) in samples from tissue homogenates or other biological fluids.