Human KERA(Keratocan) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Keratocan (KERA) ELISA Kit |
RDR-KERA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Keratocan (KERA) ELISA Kit |
RD-KERA-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Keratocan (KERA) ELISA Kit |
RD-KERA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Keratocan (KERA) ELISA Kit |
20-abx152122 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Keratocan (KERA) ELISA Kit |
abx252686-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human KERA(Keratocan) ELISA Kit |
EH3283 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: O60938
- Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Keratocan ELISA Kit (KERA) |
RK01722 |
Abclonal |
96 Tests |
EUR 521 |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
4-SEC553Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2
- SLRR2B
- Keratocan Proteoglycan
- Keratan sulfate proteoglycan keratocan
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Chicken Keratocan (KERA) ELISA Kit |
abx354671-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Keratocan (KERA) ELISA Kit |
abx354947-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Keratocan (KERA) ELISA Kit |
abx355100-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Keratocan (KERA) ELISA Kit |
abx355269-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Keratocan (KERA) ELISA Kit |
abx355357-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Keratocan (KERA) ELISA Kit |
abx389686-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Keratocan (KERA) Antibody |
abx026920-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Keratocan (KERA) Antibody |
abx026920-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Keratocan (KERA) Antibody |
20-abx177263 |
Abbexa |
|
|
|
Keratocan (KERA) Antibody |
20-abx104884 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratocan (KERA) Antibody |
20-abx129874 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratocan (KERA) Antibody |
20-abx173253 |
Abbexa |
|
|
|
Keratocan (KERA) Antibody |
20-abx321066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Keratocan (KERA) |
4-RPC553Bo01 |
Cloud-Clone |
-
EUR 539.04
-
EUR 247.00
-
EUR 1746.40
-
EUR 648.80
-
EUR 1197.60
-
EUR 424.00
-
EUR 4216.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O62702
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Bovine Keratocan expressed in: E.coli |
Recombinant Keratocan (KERa) |
4-RPC553Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35367
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Keratocan expressed in: E.coli |
ELISA kit for Human KERA (Keratocan) |
E-EL-H1794 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human KERA (Keratocan) |
ELK3438 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA).
- Show more
|
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-48T |
Abbkine |
48T |
EUR 332 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-96T |
Abbkine |
96T |
EUR 539 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Keratocan (KERA) CLIA Kit |
abx197204-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Keratocan (KERA) CLIA Kit |
20-abx493762 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Keratocan (KERA) Protein |
20-abx654110 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Cow Keratocan (KERA) Protein |
20-abx166318 |
Abbexa |
-
EUR 746.00
-
EUR 300.00
-
EUR 2346.00
-
EUR 899.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Keratocan (KERa) Protein |
20-abx167289 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CLIA kit for Human KERA (Keratocan) |
E-CL-H1116 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant |
Keratocan (KERA) Polyclonal Antibody (Bovine) |
4-PAC553Bo01 |
Cloud-Clone |
-
EUR 276.00
-
EUR 2972.00
-
EUR 730.00
-
EUR 352.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA) |
Keratocan (KERA) Polyclonal Antibody (Bovine), APC |
4-PAC553Bo01-APC |
Cloud-Clone |
-
EUR 389.00
-
EUR 3905.00
-
EUR 1070.00
-
EUR 503.00
-
EUR 238.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC. |
Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated |
4-PAC553Bo01-Biotin |
Cloud-Clone |
-
EUR 344.00
-
EUR 2922.00
-
EUR 843.00
-
EUR 427.00
-
EUR 233.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin. |
Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3 |
4-PAC553Bo01-Cy3 |
Cloud-Clone |
-
EUR 477.00
-
EUR 5165.00
-
EUR 1385.00
-
EUR 629.00
-
EUR 276.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3. |
Keratocan (KERA) Polyclonal Antibody (Bovine), FITC |
4-PAC553Bo01-FITC |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC. |
Keratocan (KERA) Polyclonal Antibody (Bovine), HRP |
4-PAC553Bo01-HRP |
Cloud-Clone |
-
EUR 354.00
-
EUR 3401.00
-
EUR 944.00
-
EUR 452.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP. |
Keratocan (KERA) Polyclonal Antibody (Bovine), PE |
4-PAC553Bo01-PE |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat) |
4-PAC553Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA) |
Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7 |
4-PAC553Bo01-APC-Cy7 |
Cloud-Clone |
-
EUR 659.00
-
EUR 7690.00
-
EUR 2020.00
-
EUR 886.00
-
EUR 356.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC |
4-PAC553Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAC553Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAC553Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAC553Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAC553Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE |
4-PAC553Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAC553Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7. |
KERA ELISA Kit (Human) (OKCD01682) |
OKCD01682 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL |
KERA Antibody |
1-CSB-PA012149ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
KERA siRNA |
20-abx921431 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KERA siRNA |
20-abx921432 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-Keratocan Antibody |
PB9653 |
BosterBio |
100ug/vial |
EUR 294 |
Human KERA shRNA Plasmid |
20-abx957578 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KERA Recombinant Protein (Human) |
RP016747 |
ABM |
100 ug |
Ask for price |
KERA cloning plasmid |
CSB-CL012149HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1059
- Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg
- Show more
|
Description: A cloning plasmid for the KERA gene. |
KERA ORF Vector (Human) (pORF) |
ORF005583 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse KERA shRNA Plasmid |
20-abx971173 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KERA Recombinant Protein (Rat) |
RP207077 |
ABM |
100 ug |
Ask for price |
KERA Recombinant Protein (Mouse) |
RP145592 |
ABM |
100 ug |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
KERA sgRNA CRISPR Lentivector set (Human) |
K1131001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Polyclonal KERA Antibody (C-term) |
AMM06186G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KERA (C-term). This antibody is tested and proven to work in the following applications: |
Kera ORF Vector (Rat) (pORF) |
ORF069027 |
ABM |
1.0 ug DNA |
EUR 506 |
Kera ORF Vector (Mouse) (pORF) |
ORF048532 |
ABM |
1.0 ug DNA |
EUR 506 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
KERA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1131002 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1131003 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1131004 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA Protein Vector (Human) (pPB-C-His) |
PV022329 |
ABM |
500 ng |
EUR 329 |
KERA Protein Vector (Human) (pPB-N-His) |
PV022330 |
ABM |
500 ng |
EUR 329 |
KERA Protein Vector (Human) (pPM-C-HA) |
PV022331 |
ABM |
500 ng |
EUR 329 |
KERA Protein Vector (Human) (pPM-C-His) |
PV022332 |
ABM |
500 ng |
EUR 329 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Polyclonal Kera antibody - C-terminal region |
AMM06187G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Kera - C-terminal region. This antibody is tested and proven to work in the following applications: |
Kera sgRNA CRISPR Lentivector set (Rat) |
K6727401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kera sgRNA CRISPR Lentivector set (Mouse) |
K3771001 |
ABM |
3 x 1.0 ug |
EUR 339 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Kera sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6727402 |
ABM |
1.0 ug DNA |
EUR 154 |
Kera sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6727403 |
ABM |
1.0 ug DNA |
EUR 154 |
Kera sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6727404 |
ABM |
1.0 ug DNA |
EUR 154 |
Kera sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3771002 |
ABM |
1.0 ug DNA |
EUR 154 |
Kera sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3771003 |
ABM |
1.0 ug DNA |
EUR 154 |
Kera sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3771004 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA Protein Vector (Rat) (pPB-C-His) |
PV276106 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Rat) (pPB-N-His) |
PV276107 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Rat) (pPM-C-HA) |
PV276108 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Rat) (pPM-C-His) |
PV276109 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Mouse) (pPB-C-His) |
PV194126 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Mouse) (pPB-N-His) |
PV194127 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Mouse) (pPM-C-HA) |
PV194128 |
ABM |
500 ng |
EUR 603 |
KERA Protein Vector (Mouse) (pPM-C-His) |
PV194129 |
ABM |
500 ng |
EUR 603 |
Kera 3'UTR Luciferase Stable Cell Line |
TU110530 |
ABM |
1.0 ml |
Ask for price |
Kera 3'UTR GFP Stable Cell Line |
TU160530 |
ABM |
1.0 ml |
Ask for price |
Kera 3'UTR Luciferase Stable Cell Line |
TU206668 |
ABM |
1.0 ml |
Ask for price |
Kera 3'UTR GFP Stable Cell Line |
TU256668 |
ABM |
1.0 ml |
Ask for price |
KERA 3'UTR GFP Stable Cell Line |
TU061606 |
ABM |
1.0 ml |
EUR 1394 |
KERA 3'UTR Luciferase Stable Cell Line |
TU011606 |
ABM |
1.0 ml |
EUR 1394 |
PrecisionX Multiplex gRNA Cloning Kit |
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1131005 |
ABM |
3 x 1.0 ug |
EUR 376 |
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV646387 |
ABM |
1.0 ug DNA |
EUR 682 |
KERA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV646391 |
ABM |
1.0 ug DNA |
EUR 682 |
KERA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV646392 |
ABM |
1.0 ug DNA |
EUR 682 |
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1131006 |
ABM |
1.0 ug DNA |
EUR 167 |
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1131007 |
ABM |
1.0 ug DNA |
EUR 167 |
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1131008 |
ABM |
1.0 ug DNA |
EUR 167 |
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K6727405 |
ABM |
3 x 1.0 ug |
EUR 376 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3771005 |
ABM |
3 x 1.0 ug |
EUR 376 |
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV646388 |
ABM |
1.0 ug DNA |
EUR 682 |
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV646389 |
ABM |
1.0 ug DNA |
EUR 740 |
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV646390 |
ABM |
1.0 ug DNA |
EUR 740 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6727406 |
ABM |
1.0 ug DNA |
EUR 167 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K6727407 |
ABM |
1.0 ug DNA |
EUR 167 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K6727408 |
ABM |
1.0 ug DNA |
EUR 167 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K3771006 |
ABM |
1.0 ug DNA |
EUR 167 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K3771007 |
ABM |
1.0 ug DNA |
EUR 167 |
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K3771008 |
ABM |
1.0 ug DNA |
EUR 167 |
AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS |
AP-STR-KIT-P |
CORNING |
1/pk |
EUR 721 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human KIT/SCFR ELISA kit |
LF-EK50791 |
Abfrontier |
1×96T |
EUR 648 |
KIT ELISA Kit (Human) (OKAN04574) |
OKAN04574 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL |
KIT ELISA Kit (Human) (OKCD06003) |
OKCD06003 |
Aviva Systems Biology |
96 Wells |
EUR 648 |
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL |
Human Pentosidine ELISA Kit |
201-12-0005 |
SunredBio |
96 tests |
EUR 440 |
- This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Amylin ELISA Kit |
201-12-0017 |
SunredBio |
96 tests |
EUR 440 |
- This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human visfatin ELISA Kit |
201-12-0026 |
SunredBio |
96 tests |
EUR 440 |
- This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Secretin ELISA Kit |
201-12-0027 |
SunredBio |
96 tests |
EUR 440 |
- This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human omentin ELISA Kit |
201-12-0156 |
SunredBio |
96 tests |
EUR 440 |
- This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
human Resistin ELISA KIT |
201-12-0339 |
SunredBio |
96 tests |
EUR 440 |
- This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Collectin ELISA Kit |
201-12-0354 |
SunredBio |
96 tests |
EUR 440 |
- This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Agrin ELISA Kit |
201-12-0414 |
SunredBio |
96 tests |
EUR 440 |
- This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Thymosin ELISA Kit |
201-12-0416 |
SunredBio |
96 tests |
EUR 440 |
- This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human talin ELISA Kit |
201-12-0620 |
SunredBio |
96 tests |
EUR 440 |
- This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human ponticulin ELISA Kit |
201-12-0633 |
SunredBio |
96 tests |
EUR 440 |
- This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Slit2 ELISA Kit |
201-12-0662 |
SunredBio |
96 tests |
EUR 440 |
- This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human trypsin ELISA Kit |
201-12-0805 |
SunredBio |
96 tests |
EUR 440 |
- This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Elastase ELISA Kit |
201-12-0812 |
SunredBio |
96 tests |
EUR 440 |
- This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human ?-glucosidase ELISA Kit |
201-12-0854 |
SunredBio |
96 tests |
EUR 440 |
- This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human ?-lactamase ELISA Kit |
201-12-0856 |
SunredBio |
96 tests |
EUR 440 |
- This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Methylase ELISA Kit |
201-12-0927 |
SunredBio |
96 tests |
EUR 440 |
- This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Pancreastatin ELISA Kit |
201-12-0984 |
SunredBio |
96 tests |
EUR 440 |
- This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Cortisol ELISA Kit |
201-12-1004 |
SunredBio |
96 tests |
EUR 440 |
- This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Renin ELISA Kit |
201-12-1017 |
SunredBio |
96 tests |
EUR 440 |
- This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human podocin ELISA Kit |
201-12-1083 |
SunredBio |
96 tests |
EUR 440 |
- This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Nephrin ELISA Kit |
201-12-1092 |
SunredBio |
96 tests |
EUR 440 |
- This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human gelson ELISA Kit |
201-12-1204 |
SunredBio |
96 tests |
EUR 440 |
- This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Salusin ? ELISA Kit |
201-12-1269 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Salusin-? ELISA Kit |
201-12-1273 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human chemerin ELISA Kit |
201-12-1436 |
SunredBio |
96 tests |
EUR 440 |
- This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human dystrophin ELISA Kit |
201-12-1446 |
SunredBio |
96 tests |
EUR 440 |
- This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human preptin ELISA Kit |
201-12-1449 |
SunredBio |
96 tests |
EUR 440 |
- This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human p16 ELISA Kit |
201-12-1638 |
SunredBio |
96 tests |
EUR 440 |
- This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
human colicin ELISA Kit |
201-12-1747 |
SunredBio |
96 tests |
EUR 440 |
- This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Amebiasis ELISA Kit |
201-12-1748 |
SunredBio |
96 tests |
EUR 440 |
- This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
human schistosoma ELISA Kit |
201-12-1749 |
SunredBio |
96 tests |
EUR 440 |
- This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Enterovirus ELISA Kit |
201-12-1809 |
SunredBio |
96 tests |
EUR 440 |
- This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human flagellin ELISA Kit |
201-12-1815 |
SunredBio |
96 tests |
EUR 440 |
- This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Cotinine ELISA Kit |
201-12-2044 |
SunredBio |
96 tests |
EUR 440 |
- This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Myostatin ELISA Kit |
201-12-2092 |
SunredBio |
96 tests |
EUR 440 |
- This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Haponin ELISA Kit |
201-12-2740 |
SunredBio |
96 tests |
EUR 440 |
- This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human ANG ELISA Kit |
55R-1555 |
Fitzgerald |
1 kit |
EUR 651 |
Description: ELISA kit for detection of ANG in the research laboratory |
Human BDNF ELISA Kit |
55R-1556 |
Fitzgerald |
1 kit |
EUR 428 |
Description: ELISA kit for detection of BDNF in the research laboratory |
Human BMP5 ELISA Kit |
55R-1559 |
Fitzgerald |
1 kit |
EUR 624 |
Description: ELISA kit for detection of BMP-5 in the research laboratory |
Human BMP2 ELISA Kit |
55R-1560 |
Fitzgerald |
1 kit |
EUR 624 |
Description: ELISA kit for detection of BMP2 in the research laboratory |
Human BMP4 ELISA Kit |
55R-1563 |
Fitzgerald |
1 kit |
EUR 651 |
Description: ELISA Kit for detection of BMP4 in the research laboratory |
Human EGF ELISA Kit |
55R-1564 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for detection of EGF in the research laboratory |
Human EGFR ELISA Kit |
55R-1566 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for detection of EGFR in the research laboratory |
Human Eotaxin ELISA Kit |
55R-1567 |
Fitzgerald |
1 kit |
EUR 530 |
Description: ELISA kit for detection of Eotaxin in the research laboratory |
Human FAS ELISA Kit |
55R-1570 |
Fitzgerald |
1 kit |
EUR 469 |
Description: ELISA kit for detection of FAS in the research laboratory |
Human FASL ELISA Kit |
55R-1572 |
Fitzgerald |
1 kit |
EUR 651 |
Description: ELISA Kit for detection of FASL in the research laboratory |
Human FGF9 ELISA Kit |
55R-1573 |
Fitzgerald |
1 kit |
EUR 671 |
Description: ELISA kit for detection of FGF9 in the research laboratory |
Human Fibronectin ELISA kit |
55R-1574 |
Fitzgerald |
1 kit |
EUR 368 |
Description: ELISA kit for the detection of Fibronectin in the research laboratory |
Human CX3CL1 ELISA Kit |
55R-1577 |
Fitzgerald |
1 kit |
EUR 617 |
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
Human CX3CL1 ELISA Kit |
55R-1578 |
Fitzgerald |
1 kit |
EUR 624 |
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
Human GCSF ELISA kit |
55R-1579 |
Fitzgerald |
1 kit |
EUR 415 |
Description: ELISA kit for the detection of Human GCSF in the research laboratory |
Human GDNF ELISA Kit |
55R-1581 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA kit for detection of GDNF in the research laboratory |
Human GMCSF ELISA kit |
55R-1583 |
Fitzgerald |
1 kit |
EUR 624 |
Description: ELISA kit for the detection of GMCSF in the research laboratory |
Human HGF ELISA kit |
55R-1586 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for the detection of Human HGF in the research laboratory |
Human ICAM1 ELISA Kit |
55R-1587 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for detection of ICAM1 in the research laboratory |
Human IGFBP1 ELISA Kit |
55R-1598 |
Fitzgerald |
1 kit |
EUR 550 |
Description: ELISA kit for detection of IGFBP1 in the research laboratory |
Human IGFBP3 ELISA kit |
55R-1600 |
Fitzgerald |
1 kit |
EUR 550 |
Description: ELISA kit for the detection of IGFBP3 in the research laboratory |
Human IL2 ELISA kit |
55R-1608 |
Fitzgerald |
1 kit |
EUR 496 |
Description: ELISA kit for the detection of IL2 in the research laboratory |
Human IL3 ELISA Kit |
55R-1611 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for detection of IL3 in the research laboratory |
Human IL4 ELISA Kit |
55R-1613 |
Fitzgerald |
1 kit |
EUR 415 |
Description: ELISA kit for detection of Human IL4 in the research laboratory |
Human IL5 ELISA kit |
55R-1616 |
Fitzgerald |
1 kit |
EUR 530 |
Description: ELISA kit for the detection of IL5 in the research laboratory |
Human IL6 ELISA Kit |
55R-1618 |
Fitzgerald |
1 kit |
EUR 415 |
Description: ELISA kit for detection of Human IL6 in the research laboratory |
Human IL8 ELISA Kit |
55R-1621 |
Fitzgerald |
1 kit |
EUR 401 |
Description: ELISA kit for detection of Human IL8 in the research laboratory |
Human IL10 ELISA Kit |
55R-1622 |
Fitzgerald |
1 kit |
EUR 401 |
Description: ELISA kit for detection of Human IL10 in the research laboratory |
Human IL15 ELISA Kit |
55R-1629 |
Fitzgerald |
1 kit |
EUR 476 |
Description: ELISA kit for detection of IL15 in the research laboratory |
Human IL17 ELISA Kit |
55R-1630 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for detection of IL17 in the research laboratory |
Human Laminin ELISA Kit |
55R-1632 |
Fitzgerald |
1 kit |
EUR 651 |
Description: ELISA kit for detection of Laminin in the research laboratory |
Human Leptin ELISA kit |
55R-1635 |
Fitzgerald |
1 kit |
EUR 476 |
Description: ELISA kit for the detection of Human Leptin in the research laboratory |
Human MCP1 ELISA kit |
55R-1639 |
Fitzgerald |
1 kit |
EUR 476 |
Description: ELISA kit for the detection of MCP1 in the research laboratory |
Human MCSF ELISA Kit |
55R-1640 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA Kit for detection of MCSF in the research laboratory |
Human MDC ELISA Kit |
55R-1642 |
Fitzgerald |
1 kit |
EUR 550 |
Description: ELISA kit for detection of MDC in the research laboratory |
Human MMP1 ELISA Kit |
55R-1648 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA kit for detection of MMP1 in the research laboratory |
Human MMP2 ELISA Kit |
55R-1649 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA kit for detection of MMP2 in the research laboratory |
Human MMP3 ELISA Kit |
55R-1651 |
Fitzgerald |
1 kit |
EUR 590 |
Description: ELISA Kit for detection of MMP3 in the research laboratory |
Human MMP8 ELISA Kit |
55R-1654 |
Fitzgerald |
1 kit |
EUR 671 |
Description: ELISA kit for detection of MMP8 in the research laboratory |
Human MMP9 ELISA kit |
55R-1655 |
Fitzgerald |
1 kit |
EUR 671 |
Description: ELISA kit for the detection of MMP9 in the research laboratory |
Human MMP13 ELISA kit |
55R-1657 |
Fitzgerald |
1 kit |
EUR 624 |
Description: ELISA kit for the detection of MMP13 in the research laboratory |
Human NGFb ELISA Kit |
55R-1658 |
Fitzgerald |
1 kit |
EUR 550 |
Description: ELISA Kit for detection of NGFb in the research laboratory |
Human OPG ELISA kit |
55R-1664 |
Fitzgerald |
1 kit |
EUR 503 |
Description: ELISA kit for the detection of OPG in the research laboratory |