Human KERA(Keratocan) ELISA Kit

Human KERA(Keratocan) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-96Tests 96 Tests
EUR 756
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-48Tests 48 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-96Tests 96 Tests
EUR 723
Human Keratocan (KERA) ELISA Kit
20-abx152122
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratocan (KERA) ELISA Kit
abx252686-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human KERA(Keratocan) ELISA Kit
EH3283 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O60938
  • Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Keratocan, KERA ELISA KIT
ELI-47900h 96 Tests
EUR 824
Human Keratocan(KERA)ELISA Kit
QY-E02810 96T
EUR 361
Human Keratocan ELISA Kit (KERA)
RK01722 96 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
SEC553Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
4-SEC553Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2
  • SLRR2B
  • Keratocan Proteoglycan
  • Keratan sulfate proteoglycan keratocan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Chicken Keratocan, KERA ELISA KIT
ELI-15851c 96 Tests
EUR 928
Bovine Keratocan, KERA ELISA KIT
ELI-31165b 96 Tests
EUR 928
Mouse Keratocan, Kera ELISA KIT
ELI-44193m 96 Tests
EUR 865
Chicken Keratocan (KERA) ELISA Kit
abx354671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Keratocan (KERA) ELISA Kit
abx354947-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Keratocan (KERA) ELISA Kit
abx355100-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Keratocan (KERA) ELISA Kit
abx355269-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Keratocan (KERA) ELISA Kit
abx355357-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Mouse Keratocan (KERA) ELISA Kit
abx389686-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Keratocan (KERA) Antibody
abx026920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
abx026920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
20-abx177263
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx104884
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx129874
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx173253
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx321066
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Keratocan (KERA)
4-RPC553Bo01
  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O62702
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Keratocan expressed in: E.coli
Recombinant Keratocan (KERa)
4-RPC553Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35367
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratocan expressed in: E.coli
ELISA kit for Human KERA (Keratocan)
E-EL-H1794 1 plate of 96 wells
EUR 534
  • Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human KERA (Keratocan)
ELK3438 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA).
  • Show more
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-48T 48T
EUR 332
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-96T 96T
EUR 539
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Keratocan (KERA) CLIA Kit
abx197204-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Keratocan (KERA) CLIA Kit
20-abx493762
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Keratocan (KERA) Protein
20-abx654110
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Cow Keratocan (KERA) Protein
20-abx166318
  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Keratocan (KERa) Protein
20-abx167289
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CLIA kit for Human KERA (Keratocan)
E-CL-H1116 1 plate of 96 wells
EUR 584
  • Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
Keratocan (KERA) Polyclonal Antibody (Bovine)
4-PAC553Bo01
  • EUR 276.00
  • EUR 2972.00
  • EUR 730.00
  • EUR 352.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC
4-PAC553Bo01-APC
  • EUR 389.00
  • EUR 3905.00
  • EUR 1070.00
  • EUR 503.00
  • EUR 238.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated
4-PAC553Bo01-Biotin
  • EUR 344.00
  • EUR 2922.00
  • EUR 843.00
  • EUR 427.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3
4-PAC553Bo01-Cy3
  • EUR 477.00
  • EUR 5165.00
  • EUR 1385.00
  • EUR 629.00
  • EUR 276.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Bovine), FITC
4-PAC553Bo01-FITC
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Bovine), HRP
4-PAC553Bo01-HRP
  • EUR 354.00
  • EUR 3401.00
  • EUR 944.00
  • EUR 452.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Bovine), PE
4-PAC553Bo01-PE
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat)
4-PAC553Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7
4-PAC553Bo01-APC-Cy7
  • EUR 659.00
  • EUR 7690.00
  • EUR 2020.00
  • EUR 886.00
  • EUR 356.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC
4-PAC553Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC553Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC553Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC553Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC553Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE
4-PAC553Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC553Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7.
KERA ELISA KIT|Human
EF006946 96 Tests
EUR 689
KERA ELISA Kit (Human) (OKCD01682)
OKCD01682 96 Wells
EUR 831
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL
KERA Antibody
1-CSB-PA012149ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
KERA siRNA
20-abx921431
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KERA siRNA
20-abx921432
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Anti-Keratocan Antibody
PB9653 100ug/vial
EUR 294
Human KERA shRNA Plasmid
20-abx957578
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Human)
RP016747 100 ug Ask for price
KERA cloning plasmid
CSB-CL012149HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg
  • Show more
Description: A cloning plasmid for the KERA gene.
KERA ORF Vector (Human) (pORF)
ORF005583 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Mouse KERA shRNA Plasmid
20-abx971173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Rat)
RP207077 100 ug Ask for price
KERA Recombinant Protein (Mouse)
RP145592 100 ug Ask for price
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
KERA sgRNA CRISPR Lentivector set (Human)
K1131001 3 x 1.0 ug
EUR 339
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Polyclonal KERA Antibody (C-term)
AMM06186G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KERA (C-term). This antibody is tested and proven to work in the following applications:
Kera ORF Vector (Rat) (pORF)
ORF069027 1.0 ug DNA
EUR 506
Kera ORF Vector (Mouse) (pORF)
ORF048532 1.0 ug DNA
EUR 506
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
KERA sgRNA CRISPR Lentivector (Human) (Target 1)
K1131002 1.0 ug DNA
EUR 154
KERA sgRNA CRISPR Lentivector (Human) (Target 2)
K1131003 1.0 ug DNA
EUR 154
KERA sgRNA CRISPR Lentivector (Human) (Target 3)
K1131004 1.0 ug DNA
EUR 154
KERA Protein Vector (Human) (pPB-C-His)
PV022329 500 ng
EUR 329
KERA Protein Vector (Human) (pPB-N-His)
PV022330 500 ng
EUR 329
KERA Protein Vector (Human) (pPM-C-HA)
PV022331 500 ng
EUR 329
KERA Protein Vector (Human) (pPM-C-His)
PV022332 500 ng
EUR 329
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9