Human KERA(Keratocan) ELISA Kit

Human KERA(Keratocan) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Keratocan (KERA) ELISA Kit
RDR-KERA-Hu-96Tests 96 Tests
EUR 756
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-48Tests 48 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-96Tests 96 Tests
EUR 723
Human Keratocan (KERA) ELISA Kit
20-abx152122
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Keratocan (KERA) ELISA Kit
abx252686-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human KERA(Keratocan) ELISA Kit
EH3283 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O60938
  • Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Keratocan, KERA ELISA KIT
ELI-47900h 96 Tests
EUR 824
Human Keratocan(KERA)ELISA Kit
QY-E02810 96T
EUR 361
Human Keratocan ELISA Kit (KERA)
RK01722 96 Tests
EUR 521
Human Keratocan (KERA) ELISA Kit
SEC553Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
SEC553Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.
Human Keratocan (KERA) ELISA Kit
4-SEC553Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2
  • SLRR2B
  • Keratocan Proteoglycan
  • Keratan sulfate proteoglycan keratocan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Chicken Keratocan, KERA ELISA KIT
ELI-15851c 96 Tests
EUR 928
Bovine Keratocan, KERA ELISA KIT
ELI-31165b 96 Tests
EUR 928
Mouse Keratocan, Kera ELISA KIT
ELI-44193m 96 Tests
EUR 865
Chicken Keratocan (KERA) ELISA Kit
abx354671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Keratocan (KERA) ELISA Kit
abx354947-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Keratocan (KERA) ELISA Kit
abx355100-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Keratocan (KERA) ELISA Kit
abx355269-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Keratocan (KERA) ELISA Kit
abx355357-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Mouse Keratocan (KERA) ELISA Kit
abx389686-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Keratocan (KERA) Antibody
abx026920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
abx026920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Keratocan (KERA) Antibody
20-abx177263
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx104884
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx129874
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Keratocan (KERA) Antibody
20-abx173253
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Keratocan (KERA) Antibody
20-abx321066
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Keratocan (KERA)
4-RPC553Bo01
  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O62702
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Keratocan expressed in: E.coli
Recombinant Keratocan (KERa)
4-RPC553Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35367
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratocan expressed in: E.coli
ELISA kit for Human KERA (Keratocan)
E-EL-H1794 1 plate of 96 wells
EUR 534
  • Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human KERA (Keratocan)
ELK3438 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA).
  • Show more
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-48T 48T
EUR 332
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Keratocan (KERA)
KTE61923-96T 96T
EUR 539
  • Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Keratocan (KERA) CLIA Kit
abx197204-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Keratocan (KERA) CLIA Kit
20-abx493762
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Keratocan (KERA) Protein
20-abx654110
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Cow Keratocan (KERA) Protein
20-abx166318
  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Keratocan (KERa) Protein
20-abx167289
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CLIA kit for Human KERA (Keratocan)
E-CL-H1116 1 plate of 96 wells
EUR 584
  • Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant
Keratocan (KERA) Polyclonal Antibody (Bovine)
4-PAC553Bo01
  • EUR 276.00
  • EUR 2972.00
  • EUR 730.00
  • EUR 352.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC
4-PAC553Bo01-APC
  • EUR 389.00
  • EUR 3905.00
  • EUR 1070.00
  • EUR 503.00
  • EUR 238.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated
4-PAC553Bo01-Biotin
  • EUR 344.00
  • EUR 2922.00
  • EUR 843.00
  • EUR 427.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3
4-PAC553Bo01-Cy3
  • EUR 477.00
  • EUR 5165.00
  • EUR 1385.00
  • EUR 629.00
  • EUR 276.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Bovine), FITC
4-PAC553Bo01-FITC
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Bovine), HRP
4-PAC553Bo01-HRP
  • EUR 354.00
  • EUR 3401.00
  • EUR 944.00
  • EUR 452.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Bovine), PE
4-PAC553Bo01-PE
  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat)
4-PAC553Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA)
Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7
4-PAC553Bo01-APC-Cy7
  • EUR 659.00
  • EUR 7690.00
  • EUR 2020.00
  • EUR 886.00
  • EUR 356.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERA (Arg21~Asn292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC
4-PAC553Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC553Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC553Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC553Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC553Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE
4-PAC553Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE.
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC553Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KERa (Gln21~His292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7.
KERA ELISA KIT|Human
EF006946 96 Tests
EUR 689
KERA ELISA Kit (Human) (OKCD01682)
OKCD01682 96 Wells
EUR 831
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL
KERA Antibody
1-CSB-PA012149ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
KERA siRNA
20-abx921431
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KERA siRNA
20-abx921432
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Anti-Keratocan Antibody
PB9653 100ug/vial
EUR 294
Human KERA shRNA Plasmid
20-abx957578
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Human)
RP016747 100 ug Ask for price
KERA cloning plasmid
CSB-CL012149HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1059
  • Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg
  • Show more
Description: A cloning plasmid for the KERA gene.
KERA ORF Vector (Human) (pORF)
ORF005583 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Mouse KERA shRNA Plasmid
20-abx971173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KERA Recombinant Protein (Rat)
RP207077 100 ug Ask for price
KERA Recombinant Protein (Mouse)
RP145592 100 ug Ask for price
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
KERA sgRNA CRISPR Lentivector set (Human)
K1131001 3 x 1.0 ug
EUR 339
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Polyclonal KERA Antibody (C-term)
AMM06186G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KERA (C-term). This antibody is tested and proven to work in the following applications:
Kera ORF Vector (Rat) (pORF)
ORF069027 1.0 ug DNA
EUR 506
Kera ORF Vector (Mouse) (pORF)
ORF048532 1.0 ug DNA
EUR 506
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
KERA sgRNA CRISPR Lentivector (Human) (Target 1)
K1131002 1.0 ug DNA
EUR 154
KERA sgRNA CRISPR Lentivector (Human) (Target 2)
K1131003 1.0 ug DNA
EUR 154
KERA sgRNA CRISPR Lentivector (Human) (Target 3)
K1131004 1.0 ug DNA
EUR 154
KERA Protein Vector (Human) (pPB-C-His)
PV022329 500 ng
EUR 329
KERA Protein Vector (Human) (pPB-N-His)
PV022330 500 ng
EUR 329
KERA Protein Vector (Human) (pPM-C-HA)
PV022331 500 ng
EUR 329
KERA Protein Vector (Human) (pPM-C-His)
PV022332 500 ng
EUR 329
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
Polyclonal Kera antibody - C-terminal region
AMM06187G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Kera - C-terminal region. This antibody is tested and proven to work in the following applications:
Kera sgRNA CRISPR Lentivector set (Rat)
K6727401 3 x 1.0 ug
EUR 339
Kera sgRNA CRISPR Lentivector set (Mouse)
K3771001 3 x 1.0 ug
EUR 339
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Kera sgRNA CRISPR Lentivector (Rat) (Target 1)
K6727402 1.0 ug DNA
EUR 154
Kera sgRNA CRISPR Lentivector (Rat) (Target 2)
K6727403 1.0 ug DNA
EUR 154
Kera sgRNA CRISPR Lentivector (Rat) (Target 3)
K6727404 1.0 ug DNA
EUR 154
Kera sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3771002 1.0 ug DNA
EUR 154
Kera sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3771003 1.0 ug DNA
EUR 154
Kera sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3771004 1.0 ug DNA
EUR 154
KERA Protein Vector (Rat) (pPB-C-His)
PV276106 500 ng
EUR 603
KERA Protein Vector (Rat) (pPB-N-His)
PV276107 500 ng
EUR 603
KERA Protein Vector (Rat) (pPM-C-HA)
PV276108 500 ng
EUR 603
KERA Protein Vector (Rat) (pPM-C-His)
PV276109 500 ng
EUR 603
KERA Protein Vector (Mouse) (pPB-C-His)
PV194126 500 ng
EUR 603
KERA Protein Vector (Mouse) (pPB-N-His)
PV194127 500 ng
EUR 603
KERA Protein Vector (Mouse) (pPM-C-HA)
PV194128 500 ng
EUR 603
KERA Protein Vector (Mouse) (pPM-C-His)
PV194129 500 ng
EUR 603
Kera 3'UTR Luciferase Stable Cell Line
TU110530 1.0 ml Ask for price
Kera 3'UTR GFP Stable Cell Line
TU160530 1.0 ml Ask for price
Kera 3'UTR Luciferase Stable Cell Line
TU206668 1.0 ml Ask for price
Kera 3'UTR GFP Stable Cell Line
TU256668 1.0 ml Ask for price
KERA 3'UTR GFP Stable Cell Line
TU061606 1.0 ml
EUR 1394
KERA 3'UTR Luciferase Stable Cell Line
TU011606 1.0 ml
EUR 1394
PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1131005 3 x 1.0 ug
EUR 376
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV646387 1.0 ug DNA
EUR 682
KERA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV646391 1.0 ug DNA
EUR 682
KERA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV646392 1.0 ug DNA
EUR 682
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1131006 1.0 ug DNA
EUR 167
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1131007 1.0 ug DNA
EUR 167
KERA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1131008 1.0 ug DNA
EUR 167
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6727405 3 x 1.0 ug
EUR 376
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3771005 3 x 1.0 ug
EUR 376
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV646388 1.0 ug DNA
EUR 682
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV646389 1.0 ug DNA
EUR 740
KERA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV646390 1.0 ug DNA
EUR 740
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6727406 1.0 ug DNA
EUR 167
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6727407 1.0 ug DNA
EUR 167
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6727408 1.0 ug DNA
EUR 167
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3771006 1.0 ug DNA
EUR 167
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3771007 1.0 ug DNA
EUR 167
Kera sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3771008 1.0 ug DNA
EUR 167
AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
Human Kit ELISA Kit
ELA-E0121h 96 Tests
EUR 824
Human KIT/SCFR ELISA kit
LF-EK50791 1×96T
EUR 648
KIT ELISA Kit (Human) (OKAN04574)
OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL
KIT ELISA Kit (Human) (OKCD06003)
OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL
Human Pentosidine ELISA Kit
201-12-0005 96 tests
EUR 440
  • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Amylin ELISA Kit
201-12-0017 96 tests
EUR 440
  • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human visfatin ELISA Kit
201-12-0026 96 tests
EUR 440
  • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Secretin ELISA Kit
201-12-0027 96 tests
EUR 440
  • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human omentin ELISA Kit
201-12-0156 96 tests
EUR 440
  • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human Resistin ELISA KIT
201-12-0339 96 tests
EUR 440
  • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Collectin ELISA Kit
201-12-0354 96 tests
EUR 440
  • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Agrin ELISA Kit
201-12-0414 96 tests
EUR 440
  • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thymosin ELISA Kit
201-12-0416 96 tests
EUR 440
  • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human talin ELISA Kit
201-12-0620 96 tests
EUR 440
  • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ponticulin ELISA Kit
201-12-0633 96 tests
EUR 440
  • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Slit2 ELISA Kit
201-12-0662 96 tests
EUR 440
  • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human trypsin ELISA Kit
201-12-0805 96 tests
EUR 440
  • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Elastase ELISA Kit
201-12-0812 96 tests
EUR 440
  • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ?-glucosidase ELISA Kit
201-12-0854 96 tests
EUR 440
  • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ?-lactamase ELISA Kit
201-12-0856 96 tests
EUR 440
  • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Methylase ELISA Kit
201-12-0927 96 tests
EUR 440
  • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Pancreastatin ELISA Kit
201-12-0984 96 tests
EUR 440
  • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Cortisol ELISA Kit
201-12-1004 96 tests
EUR 440
  • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Renin ELISA Kit
201-12-1017 96 tests
EUR 440
  • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human podocin ELISA Kit
201-12-1083 96 tests
EUR 440
  • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Nephrin ELISA Kit
201-12-1092 96 tests
EUR 440
  • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human gelson ELISA Kit
201-12-1204 96 tests
EUR 440
  • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Salusin ? ELISA Kit
201-12-1269 96 tests
EUR 440
  • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Salusin-? ELISA Kit
201-12-1273 96 tests
EUR 440
  • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human chemerin ELISA Kit
201-12-1436 96 tests
EUR 440
  • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human dystrophin ELISA Kit
201-12-1446 96 tests
EUR 440
  • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human preptin ELISA Kit
201-12-1449 96 tests
EUR 440
  • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human p16 ELISA Kit
201-12-1638 96 tests
EUR 440
  • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human colicin ELISA Kit
201-12-1747 96 tests
EUR 440
  • This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Amebiasis ELISA Kit
201-12-1748 96 tests
EUR 440
  • This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
human schistosoma ELISA Kit
201-12-1749 96 tests
EUR 440
  • This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Enterovirus ELISA Kit
201-12-1809 96 tests
EUR 440
  • This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human flagellin ELISA Kit
201-12-1815 96 tests
EUR 440
  • This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Cotinine ELISA Kit
201-12-2044 96 tests
EUR 440
  • This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Myostatin ELISA Kit
201-12-2092 96 tests
EUR 440
  • This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Haponin ELISA Kit
201-12-2740 96 tests
EUR 440
  • This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human ANG ELISA Kit
55R-1555 1 kit
EUR 651
Description: ELISA kit for detection of ANG in the research laboratory
Human BDNF ELISA Kit
55R-1556 1 kit
EUR 428
Description: ELISA kit for detection of BDNF in the research laboratory
Human BMP5 ELISA Kit
55R-1559 1 kit
EUR 624
Description: ELISA kit for detection of BMP-5 in the research laboratory
Human BMP2 ELISA Kit
55R-1560 1 kit
EUR 624
Description: ELISA kit for detection of BMP2 in the research laboratory
Human BMP4 ELISA Kit
55R-1563 1 kit
EUR 651
Description: ELISA Kit for detection of BMP4 in the research laboratory
Human EGF ELISA Kit
55R-1564 1 kit
EUR 503
Description: ELISA kit for detection of EGF in the research laboratory
Human EGFR ELISA Kit
55R-1566 1 kit
EUR 503
Description: ELISA kit for detection of EGFR in the research laboratory
Human Eotaxin ELISA Kit
55R-1567 1 kit
EUR 530
Description: ELISA kit for detection of Eotaxin in the research laboratory
Human FAS ELISA Kit
55R-1570 1 kit
EUR 469
Description: ELISA kit for detection of FAS in the research laboratory
Human FASL ELISA Kit
55R-1572 1 kit
EUR 651
Description: ELISA Kit for detection of FASL in the research laboratory
Human FGF9 ELISA Kit
55R-1573 1 kit
EUR 671
Description: ELISA kit for detection of FGF9 in the research laboratory
Human Fibronectin ELISA kit
55R-1574 1 kit
EUR 368
Description: ELISA kit for the detection of Fibronectin in the research laboratory
Human CX3CL1 ELISA Kit
55R-1577 1 kit
EUR 617
Description: ELISA Kit for detection of CX3CL1 in the research laboratory
Human CX3CL1 ELISA Kit
55R-1578 1 kit
EUR 624
Description: ELISA Kit for detection of CX3CL1 in the research laboratory
Human GCSF ELISA kit
55R-1579 1 kit
EUR 415
Description: ELISA kit for the detection of Human GCSF in the research laboratory
Human GDNF ELISA Kit
55R-1581 1 kit
EUR 590
Description: ELISA kit for detection of GDNF in the research laboratory
Human GMCSF ELISA kit
55R-1583 1 kit
EUR 624
Description: ELISA kit for the detection of GMCSF in the research laboratory
Human HGF ELISA kit
55R-1586 1 kit
EUR 503
Description: ELISA kit for the detection of Human HGF in the research laboratory
Human ICAM1 ELISA Kit
55R-1587 1 kit
EUR 503
Description: ELISA kit for detection of ICAM1 in the research laboratory
Human IGFBP1 ELISA Kit
55R-1598 1 kit
EUR 550
Description: ELISA kit for detection of IGFBP1 in the research laboratory
Human IGFBP3 ELISA kit
55R-1600 1 kit
EUR 550
Description: ELISA kit for the detection of IGFBP3 in the research laboratory
Human IL2 ELISA kit
55R-1608 1 kit
EUR 496
Description: ELISA kit for the detection of IL2 in the research laboratory
Human IL3 ELISA Kit
55R-1611 1 kit
EUR 503
Description: ELISA kit for detection of IL3 in the research laboratory
Human IL4 ELISA Kit
55R-1613 1 kit
EUR 415
Description: ELISA kit for detection of Human IL4 in the research laboratory
Human IL5 ELISA kit
55R-1616 1 kit
EUR 530
Description: ELISA kit for the detection of IL5 in the research laboratory
Human IL6 ELISA Kit
55R-1618 1 kit
EUR 415
Description: ELISA kit for detection of Human IL6 in the research laboratory
Human IL8 ELISA Kit
55R-1621 1 kit
EUR 401
Description: ELISA kit for detection of Human IL8 in the research laboratory
Human IL10 ELISA Kit
55R-1622 1 kit
EUR 401
Description: ELISA kit for detection of Human IL10 in the research laboratory
Human IL15 ELISA Kit
55R-1629 1 kit
EUR 476
Description: ELISA kit for detection of IL15 in the research laboratory
Human IL17 ELISA Kit
55R-1630 1 kit
EUR 503
Description: ELISA kit for detection of IL17 in the research laboratory
Human Laminin ELISA Kit
55R-1632 1 kit
EUR 651
Description: ELISA kit for detection of Laminin in the research laboratory
Human Leptin ELISA kit
55R-1635 1 kit
EUR 476
Description: ELISA kit for the detection of Human Leptin in the research laboratory
Human MCP1 ELISA kit
55R-1639 1 kit
EUR 476
Description: ELISA kit for the detection of MCP1 in the research laboratory
Human MCSF ELISA Kit
55R-1640 1 kit
EUR 503
Description: ELISA Kit for detection of MCSF in the research laboratory
Human MDC ELISA Kit
55R-1642 1 kit
EUR 550
Description: ELISA kit for detection of MDC in the research laboratory
Human MMP1 ELISA Kit
55R-1648 1 kit
EUR 590
Description: ELISA kit for detection of MMP1 in the research laboratory
Human MMP2 ELISA Kit
55R-1649 1 kit
EUR 590
Description: ELISA kit for detection of MMP2 in the research laboratory
Human MMP3 ELISA Kit
55R-1651 1 kit
EUR 590
Description: ELISA Kit for detection of MMP3 in the research laboratory
Human MMP8 ELISA Kit
55R-1654 1 kit
EUR 671
Description: ELISA kit for detection of MMP8 in the research laboratory
Human MMP9 ELISA kit
55R-1655 1 kit
EUR 671
Description: ELISA kit for the detection of MMP9 in the research laboratory
Human MMP13 ELISA kit
55R-1657 1 kit
EUR 624
Description: ELISA kit for the detection of MMP13 in the research laboratory
Human NGFb ELISA Kit
55R-1658 1 kit
EUR 550
Description: ELISA Kit for detection of NGFb in the research laboratory
Human OPG ELISA kit
55R-1664 1 kit
EUR 503
Description: ELISA kit for the detection of OPG in the research laboratory