Human GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1) ELISA Kit

Human GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx129033	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx005070	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx172649	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)
4-RPH975Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P80108 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.7kDa Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
20-abx151715	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx250820-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 ELISA Kit (GPLD1)
RK01496	Abclonal	96 Tests	EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
4-SEH975Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glycosylphosphatidylinositol Specific Phospholipase D1 elisa. Alternative names of the recognized antigen: GPIPLD GPIPLDM PIGPLD PIGPLD1 Glycoprotein phospholipase D Glycosyl-phosphatidylinositol-specific phospholipase D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein
20-abx168135	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx361319-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx362401-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx356152-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx359589-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit
abx195711-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit
20-abx495589	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)
ELK3447	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Specific Phospholipase D1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)
E-EL-H0397	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GPLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human)
4-PAH975Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

Guinea pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx357367-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CLIA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)
E-CL-H0323	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's GPLD1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC
4-PAH975Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Biotinylated
4-PAH975Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Biotin.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Cy3
4-PAH975Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Cy3.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), FITC
4-PAH975Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with FITC.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), HRP
4-PAH975Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with HRP.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), PE
4-PAH975Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with PE.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC-Cy7
4-PAH975Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GPLD1 (Met496~Asp840) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC-Cy7.

Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx573546-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E1050Hu	Sunlong	1 Kit	EUR 605

Human GPLD1(Phosphatidylinositol-glycan-specific phospholipase D) ELISA Kit
EH1534	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: P80108 Alias: GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1)/GPIPLD/GPIPLDM/PIGPLD/PIGPLD1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit
CSB-EL009721HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit
1-CSB-EL009721HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516609-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516611-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit
abx516612-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Bovine GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E0302Bo	Sunlong	1 Kit	EUR 717

Mouse Gpld1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit
E1647Mo	Sunlong	1 Kit	EUR 632

Phospholipase D1, Phosphatidylcholine-Specific Antibody
20-abx114491	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-48T	Abbkine	48T	EUR 332
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)
KTE61937-96T	Abbkine	96T	EUR 539
Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Phospholipase D1 ELISA kit
E01P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 ELISA kit
E01P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 ELISA kit
E01P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 (PLD1) ELISA Kit
abx516744-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

ELISA kit for Human Phospholipase D1
EK3334	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phospholipase D1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PLD1/ Phospholipase D1 ELISA Kit
E1961Hu	Sunlong	1 Kit	EUR 605

Human PLD1(Phospholipase D1) ELISA Kit
EH1563	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: Q13393 Alias: PLD1/Phospholipase D1/Choline phosphatase 1/hPLD1/Phosphatidylcholine-hydrolyzing phospholipase D1/phospholipase D1, phophatidylcholine-specific
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Phospholipase D1, PLD1 ELISA KIT
ELI-36375h	Lifescience Market	96 Tests	EUR 824

Human Phospholipase D1 (PLD1) ELISA Kit
abx250852-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Phospholipase D1 (PLD1)ELISA Kit
201-12-2641	SunredBio	96 tests	EUR 440
This Phospholipase D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Phospholipase D1(PLD1) ELISA kit
CSB-EL018144HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1 (PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phospholipase D1(PLD1) ELISA kit
1-CSB-EL018144HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1(PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Phospholipase D1(PLD1)ELISA Kit
QY-E02288	Qayee Biotechnology	96T	EUR 361

Rat Phospholipase D1 ELISA kit
E02P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase D1 ELISA kit
E02P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase D1 ELISA kit
E02P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit
E03P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit
E03P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit
E03P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit
E04P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit
E04P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit
E04P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit
E06P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit
E06P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit
E06P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit
E07P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit
E07P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit
E07P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit
E08P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit
E08P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit
E08P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit
E09P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit
E09P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit
E09P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human PLD1 (Phospholipase D1)
E-EL-H1595	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLD1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLD1 (Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

anti-Phospholipase D1
YF-PA24392	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Phospholipase D1

Mouse Phospholipase D1 (PLD1) ELISA Kit
abx516745-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Phospholipase D1 (PLD1) ELISA Kit
abx516746-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Guinea pig Phospholipase D1 ELISA kit
E05P0953-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phospholipase D1 ELISA kit
E05P0953-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phospholipase D1 ELISA kit
E05P0953-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pld1/ Phospholipase D1 ELISA Kit
E1153Mo	Sunlong	1 Kit	EUR 632

Mouse Phospholipase D1, Pld1 ELISA KIT
ELI-45228m	Lifescience Market	96 Tests	EUR 865

Pld1 ELISA Kit| Rat Phospholipase D1 ELISA Kit
EF019192	Lifescience Market	96 Tests	EUR 689

Pld1 ELISA Kit| Mouse Phospholipase D1 ELISA Kit
EF015900	Lifescience Market	96 Tests	EUR 689

Gpld1 ELISA Kit| Rat Phosphatidylinositol-glycan-specific phosp
EF018760	Lifescience Market	96 Tests	EUR 689

Gpld1 ELISA Kit| Mouse Phosphatidylinositol-glycan-specific pho
EF015080	Lifescience Market	96 Tests	EUR 689

GPLD1 ELISA Kit| Bovine Phosphatidylinositol-glycan-specific ph
EF011449	Lifescience Market	96 Tests	EUR 689

Human GPLD1 ELISA Kit
ELA-E13691h	Lifescience Market	96 Tests	EUR 824

GPLD1 ELISA KIT|Human
EF005585	Lifescience Market	96 Tests	EUR 689

Phospholipase D1 (PLD1) Antibody
20-abx326421	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody
20-abx326659	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody
20-abx217813	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody
abx236530-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Phospholipase D1 (PLD1) Antibody
20-abx301070	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Phospholipase D1 (2F3)
YF-MA14765	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Phospholipase D1

Anti-Phospholipase D1 (10H2)
YF-MA14766	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Phospholipase D1

Human Phosphoinositide specific phospholipase C ELISA kit
E01P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoinositide specific phospholipase C ELISA kit
E01P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoinositide specific phospholipase C ELISA kit
E01P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human G1/S-specific Cyclin-D1 ELISA Kit
CSB-E08286h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human G1/S-specific Cyclin-D1 ELISA Kit
1-CSB-E08286h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

GPLD1 ELISA Kit (Human) (OKAN05580)
OKAN05580	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

GPLD1 ELISA Kit (Human) (OKCD09132)
OKCD09132	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL

GPLD1 ELISA Kit (Human) (OKEH02315)
OKEH02315	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

Phospholipase D1 (PLD1) Antibody (HRP)
20-abx316197	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody (FITC)
20-abx316198	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody (Biotin)
20-abx316199	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-PLD1/Phospholipase D1 Antibody
A02031	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for PHOSPHOLIPASE D1/PLD1 detection. Tested for IHC in Human, Mouse, Rat.

Anti-Phospholipase D1/PLD1 Antibody
PB9380	BosterBio	100ug/vial	EUR 294

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit
GA-E0804HM-48T	GenAsia Biotech	48T	EUR 289

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit
GA-E0804HM-96T	GenAsia Biotech	96T	EUR 466

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit
201-12-0788	SunredBio	96 tests	EUR 440
This phosphoinositide-specific phospholipase C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit
CN-04440H1	ChemNorm	96T	EUR 478

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit
CN-04440H2	ChemNorm	48T	EUR 329

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit
QY-E02264	Qayee Biotechnology	96T	EUR 400

Human CCND1/ G1/S-specific cyclin-D1 ELISA Kit
E0393Hu	Sunlong	1 Kit	EUR 571

G1/S-specific cyclin-D1(CCND1) (Human) ELISA Kit
E4287-100	Biovision		EUR 805

Human CCND1(G1/S-specific cyclin-D1) ELISA Kit
EH0970	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P24385 Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human G1/S- specific cyclin- D1, CCND1 ELISA KIT
ELI-02098h	Lifescience Market	96 Tests	EUR 824

Rat Phosphoinositide specific phospholipase C ELISA kit
E02P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoinositide specific phospholipase C ELISA kit
E02P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoinositide specific phospholipase C ELISA kit
E02P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit
E03P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit
E03P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit
E03P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit
E04P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit
E04P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit
E04P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit
E06P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit
E06P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit
E06P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit
E07P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit
E07P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit
E07P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit
E08P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit
E08P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit
E08P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit
E09P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit
E09P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit
E09P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D
EK3272	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit
E05P0664-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit
E05P0664-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit
E05P0664-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GPLD1 ELISA Kit (Bovine) (OKEH03927)
OKEH03927	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL

Mouse Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit
E0235Mo	Sunlong	1 Kit	EUR 571

ELISA kit for Rat G1/S-specific cyclin-D1
EK1987	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat G1/S-specific cyclin-D1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Bovine G1/S- specific cyclin- D1, CCND1 ELISA KIT
ELI-02101b	Lifescience Market	96 Tests	EUR 928

Mouse G1/S- specific cyclin- D1, Ccnd1 ELISA KIT
ELI-02102m	Lifescience Market	96 Tests	EUR 865

Chicken G1/S- specific cyclin- D1, CCND1 ELISA KIT
ELI-02103c	Lifescience Market	96 Tests	EUR 928

Rat Ccnd1(G1/S-specific cyclin-D1) ELISA Kit
ER0328	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P39948 Alias: Ccnd1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse CCND1(G1/S-specific cyclin-D1) ELISA Kit
EM0414	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P25322 Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Bovine CCND1/ G1/S-specific cyclin-D1 ELISA Kit
E0054Bo	Sunlong	1 Kit	EUR 717

Rat Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit
E0173Ra	Sunlong	1 Kit	EUR 571

Human G1/S-specific cyclin-D1 (CCND1)
1-CSB-EP004811HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 37.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human G1/S-specific cyclin-D1(CCND1) expressed in E.coli

Ccnd1 ELISA Kit| Rat G1/S-specific cyclin-D1 ELISA Kit
EF017201	Lifescience Market	96 Tests	EUR 689

CCND1 ELISA Kit| Mouse G1/S-specific cyclin-D1 ELISA Kit
EF013067	Lifescience Market	96 Tests	EUR 689

Human PLCγ2(Phospholipase C Gamma 2, Phosphatidylinositol Specific) ELISA Kit
EH3615	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P16885 Alias: PLCγ2/PLCG2/Phosphoinositide phospholipase C-gamma-2/phospholipase C gamma 2/phospholipase C, gamma 2(phosphatidylinositol-specific)/phospholipase C, gamma 2(phosphatidylyinositol-specific)/P Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
20-abx152775	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Phospholipase C Beta 1, Phosphoinositide Specific (PLCB1) ELISA Kit
abx251153-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx253002-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
DLR-PLCg2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
DLR-PLCg2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
RD-PLCg2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
RD-PLCg2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
RDR-PLCg2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
RDR-PLCg2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
SED841Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
SED841Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
SED841Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
SED841Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit
4-SED841Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phospholipase C Gamma 2, Phosphatidylinositol Specific elisa. Alternative names of the recognized antigen: PLC-IV Phosphoinositide phospholipase C-gamma-2 1-phosphatidylinositol 4, 5-bisphosphate phosphodiesterase gamma-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Polyclonal PLD1 / Phospholipase D1 Antibody (aa527-576)
AMR09364G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLD1 / Phospholipase D1 (aa527-576). This antibody is tested and proven to work in the following applications:

Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody
20-abx012716	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Phospholipase D1 Phospho-Ser561 (PLD1 pS561) Antibody
20-abx326718	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody
20-abx327761	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

G1 / S-specific cyclin-D1 Antibody
abx018121-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

Nicotiana alata Flower-specific defensin (D1)
1-CSB-EP814081NDF	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 21.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Nicotiana alata Flower-specific defensin(D1) expressed in E.coli

ELISA kit for Bovine Phosphatidylinositol-glycan-specific phospholipase D
EK3273	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

GPLD1 Antibody
ABD9750	Lifescience Market	100 ug	EUR 438

GPLD1 siRNA
20-abx918384	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPLD1 siRNA
20-abx918385	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPLD1 antibody
39044-100ul	SAB	100ul	EUR 252

GPLD1 Antibody
DF9750	Affbiotech	200ul	EUR 304
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

GPLD1 Antibody
1-CSB-PA009721LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-GPLD1
YF-PA12100	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to GPLD1

anti-GPLD1
YF-PA12101	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GPLD1

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored
EF015079	Lifescience Market	96 Tests	EUR 689

Human Phosphatidylinositol- glycan- specific phospholipase D, GP
ELI-37994h	Lifescience Market	96 Tests	EUR 824

Recombinant human Phosphatidylinositol-glycan-specific phospholipase D
P1476	FN Test	100ug	Ask for price
Uniprot ID: P80108 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan-specific phospholipase D

Human Cyclin D1 ELISA kit
E01C0483-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin D1 ELISA kit
E01C0483-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin D1 ELISA kit
E01C0483-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit
E01R0474-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit
E01R0474-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit
E01R0474-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin-D1 ELISA Kit
GA-E1653HM-48T	GenAsia Biotech	48T	EUR 289

Human Cyclin-D1 ELISA Kit
GA-E1653HM-96T	GenAsia Biotech	96T	EUR 466

Human Cyclin-D1 ELISA Kit
201-12-1637	SunredBio	96 tests	EUR 440
This Cyclin-D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cyclin-D1 ELISA Kit
CN-03559H1	ChemNorm	96T	EUR 476

Human Cyclin-D1 ELISA Kit
CN-03559H2	ChemNorm	48T	EUR 326

Human Cyclin-D1 ELISA Kit
QY-E00939	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human PLCg2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific)
ELK3787	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLC?2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con Show more
Description: A sandwich ELISA kit for detection of Phospholipase C Gamma 2, Phosphatidylinositol Specific from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cyclin-D1/ Rat Cyclin- D1 ELISA Kit
ELA-E0585r	Lifescience Market	96 Tests	EUR 886

Human GPLD1 shRNA Plasmid
20-abx951887	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monkey Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit
abx360344-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx361179-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit
abx362040-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx362856-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit
abx363285-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx364145-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx355885-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit
abx356854-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit
abx359426-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Anti-HDAC6 Monoclonal Antibody (D1 domain-specific)
A1485-100	Biovision		EUR 370

Anti-HDAC6 Monoclonal Antibody (D1 domain-specific)
A1486-100	Biovision		EUR 370

Gpaa1 ELISA Kit| Mouse Glycosylphosphatidylinositol anchor atta
EF015090	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific)
E-EL-H0966	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PLC?2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLC?2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific) in samples from Serum, Plasma, Cell supernatant

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) CLIA Kit
20-abx494409	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCγ2) CLIA Kit
abx197465-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

GPLD1 Conjugated Antibody
C39044	SAB	100ul	EUR 397

GPLD1 cloning plasmid
CSB-CL009721HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 531 Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Rabbit pAb
A6612-100ul	Abclonal	100 ul	EUR 308

GPLD1 Rabbit pAb
A6612-200ul	Abclonal	200 ul	EUR 459

GPLD1 Rabbit pAb
A6612-20ul	Abclonal	20 ul	EUR 183

GPLD1 Rabbit pAb
A6612-50ul	Abclonal	50 ul	EUR 223

GPLD1 Blocking Peptide
DF9750-BP	Affbiotech	1mg	EUR 195

Anti-GPLD1 antibody
STJ28695	St John's Laboratory	100 µl	EUR 277
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
abx570812-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
20-abx151698	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit
abx387626-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)ELISA Kit
201-12-2723	SunredBio	96 tests	EUR 440
This Glycosylphosphatidylinositol Anchored Molecule Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
DLR-GML-Hu-48T	DL Develop	48T	EUR 517
Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
DLR-GML-Hu-96T	DL Develop	96T	EUR 673
Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RD-GML-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RD-GML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RDR-GML-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RDR-GML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein(GML)ELISA Kit
QY-E04903	Qayee Biotechnology	96T	EUR 361

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
4-SEG832Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glycosylphosphatidylinositol Anchored Molecule Like Protein elisa. Alternative names of the recognized antigen: LY6DL GPI Anchored Molecule Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Cyclin D1 (CCND1) ELISA Kit
abx571993-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Dopamine Receptor D1 ELISA kit
E01D0044-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine Receptor D1 ELISA kit
E01D0044-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine Receptor D1 ELISA kit
E01D0044-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit
E01P0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit
E01P0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit
E01P0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin D1 PicoKine ELISA Kit
EK1968	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Serpin D1 in cell culture supernates, serum and plasma (EDTA, citrate) and urine.

Human Plexin- D1, PLXND1 ELISA KIT
ELI-45235h	Lifescience Market	96 Tests	EUR 824

Human Cyclin D1 (CCND1) ELISA Kit
20-abx151222	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cyclin D1 (CCND1) ELISA Kit
abx051526-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-10 working days.

Human Cyclin D1 (CCND1) ELISA Kit
abx253925-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Plexin D1 (PLXND1)ELISA Kit
201-12-2640	SunredBio	96 tests	EUR 440
This Plexin D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.