Human GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
RDR-GPLD1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
RDR-GPLD1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody |
20-abx129033 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody |
20-abx005070 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody |
20-abx172649 |
Abbexa |
|
|
|
Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) |
4-RPH975Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P80108
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.7kDa
- Isoelectric Point: 6.9
|
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
20-abx151715 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx250820-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Glycosylphosphatidylinositol Specific Phospholipase D1 ELISA Kit (GPLD1) |
RK01496 |
Abclonal |
96 Tests |
EUR 521 |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
SEH975Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids. |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
SEH975Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids. |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
SEH975Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids. |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
SEH975Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids. |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
4-SEH975Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glycosylphosphatidylinositol Specific Phospholipase D1 elisa. Alternative names of the recognized antigen: GPIPLD
- GPIPLDM
- PIGPLD
- PIGPLD1
- Glycoprotein phospholipase D
- Glycosyl-phosphatidylinositol-specific phospholipase D
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein |
20-abx168135 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx361319-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx362401-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx356152-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx359589-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit |
abx195711-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit |
20-abx495589 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) |
ELK3447 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
- Show more
|
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Specific Phospholipase D1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) |
E-EL-H0397 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GPLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human) |
4-PAH975Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) |
Guinea pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit |
abx357367-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CLIA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) |
E-CL-H0323 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's GPLD1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC |
4-PAH975Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Biotinylated |
4-PAH975Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Biotin. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Cy3 |
4-PAH975Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Cy3. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), FITC |
4-PAH975Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with FITC. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), HRP |
4-PAH975Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with HRP. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), PE |
4-PAH975Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with PE. |
Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH975Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GPLD1 (Met496~Asp840)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC-Cy7. |
Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit |
abx573546-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit |
E1050Hu |
Sunlong |
1 Kit |
EUR 605 |
Human GPLD1(Phosphatidylinositol-glycan-specific phospholipase D) ELISA Kit |
EH1534 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.781-50 ng/ml
- Uniprot ID: P80108
- Alias: GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1)/GPIPLD/GPIPLDM/PIGPLD/PIGPLD1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit |
CSB-EL009721HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit |
1-CSB-EL009721HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Cow Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit |
abx516609-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit |
abx516611-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit |
abx516612-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Bovine GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit |
E0302Bo |
Sunlong |
1 Kit |
EUR 717 |
Mouse Gpld1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit |
E1647Mo |
Sunlong |
1 Kit |
EUR 632 |
Phospholipase D1, Phosphatidylcholine-Specific Antibody |
20-abx114491 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) |
KTE61937-48T |
Abbkine |
48T |
EUR 332 |
- Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) |
KTE61937-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) |
KTE61937-96T |
Abbkine |
96T |
EUR 539 |
- Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Phospholipase D1 ELISA kit |
E01P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase D1 ELISA kit |
E01P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase D1 ELISA kit |
E01P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase D1 (PLD1) ELISA Kit |
abx516744-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Phospholipase D1 |
EK3334 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phospholipase D1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human PLD1/ Phospholipase D1 ELISA Kit |
E1961Hu |
Sunlong |
1 Kit |
EUR 605 |
Human PLD1(Phospholipase D1) ELISA Kit |
EH1563 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q13393
- Alias: PLD1/Phospholipase D1/Choline phosphatase 1/hPLD1/Phosphatidylcholine-hydrolyzing phospholipase D1/phospholipase D1, phophatidylcholine-specific
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Phospholipase D1 (PLD1) ELISA Kit |
abx250852-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Phospholipase D1 (PLD1)ELISA Kit |
201-12-2641 |
SunredBio |
96 tests |
EUR 440 |
- This Phospholipase D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Phospholipase D1(PLD1) ELISA kit |
CSB-EL018144HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1 (PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Phospholipase D1(PLD1) ELISA kit |
1-CSB-EL018144HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1(PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Phospholipase D1 ELISA kit |
E02P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase D1 ELISA kit |
E02P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phospholipase D1 ELISA kit |
E02P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phospholipase D1 ELISA kit |
E03P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phospholipase D1 ELISA kit |
E03P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phospholipase D1 ELISA kit |
E03P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phospholipase D1 ELISA kit |
E04P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phospholipase D1 ELISA kit |
E04P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phospholipase D1 ELISA kit |
E04P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phospholipase D1 ELISA kit |
E06P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phospholipase D1 ELISA kit |
E06P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phospholipase D1 ELISA kit |
E06P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phospholipase D1 ELISA kit |
E07P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phospholipase D1 ELISA kit |
E07P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phospholipase D1 ELISA kit |
E07P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phospholipase D1 ELISA kit |
E08P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phospholipase D1 ELISA kit |
E08P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phospholipase D1 ELISA kit |
E08P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phospholipase D1 ELISA kit |
E09P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phospholipase D1 ELISA kit |
E09P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phospholipase D1 ELISA kit |
E09P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human PLD1 (Phospholipase D1) |
E-EL-H1595 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLD1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PLD1 (Phospholipase D1) in samples from Serum, Plasma, Cell supernatant |
anti-Phospholipase D1 |
YF-PA24392 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Phospholipase D1 |
Mouse Phospholipase D1 (PLD1) ELISA Kit |
abx516745-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Phospholipase D1 (PLD1) ELISA Kit |
abx516746-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Guinea pig Phospholipase D1 ELISA kit |
E05P0953-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Phospholipase D1 ELISA kit |
E05P0953-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Phospholipase D1 ELISA kit |
E05P0953-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Pld1/ Phospholipase D1 ELISA Kit |
E1153Mo |
Sunlong |
1 Kit |
EUR 632 |
Pld1 ELISA Kit| Rat Phospholipase D1 ELISA Kit |
EF019192 |
Lifescience Market |
96 Tests |
EUR 689 |
Pld1 ELISA Kit| Mouse Phospholipase D1 ELISA Kit |
EF015900 |
Lifescience Market |
96 Tests |
EUR 689 |
Gpld1 ELISA Kit| Rat Phosphatidylinositol-glycan-specific phosp |
EF018760 |
Lifescience Market |
96 Tests |
EUR 689 |
Gpld1 ELISA Kit| Mouse Phosphatidylinositol-glycan-specific pho |
EF015080 |
Lifescience Market |
96 Tests |
EUR 689 |
GPLD1 ELISA Kit| Bovine Phosphatidylinositol-glycan-specific ph |
EF011449 |
Lifescience Market |
96 Tests |
EUR 689 |
Phospholipase D1 (PLD1) Antibody |
20-abx326421 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase D1 (PLD1) Antibody |
20-abx326659 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase D1 (PLD1) Antibody |
20-abx217813 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase D1 (PLD1) Antibody |
abx236530-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Phospholipase D1 (PLD1) Antibody |
20-abx301070 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Phospholipase D1 (2F3) |
YF-MA14765 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Phospholipase D1 |
Anti-Phospholipase D1 (10H2) |
YF-MA14766 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Phospholipase D1 |
Human Phosphoinositide specific phospholipase C ELISA kit |
E01P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphoinositide specific phospholipase C ELISA kit |
E01P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphoinositide specific phospholipase C ELISA kit |
E01P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human G1/S-specific Cyclin-D1 ELISA Kit |
CSB-E08286h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human G1/S-specific Cyclin-D1 ELISA Kit |
1-CSB-E08286h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
GPLD1 ELISA Kit (Human) (OKAN05580) |
OKAN05580 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL |
GPLD1 ELISA Kit (Human) (OKCD09132) |
OKCD09132 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL |
GPLD1 ELISA Kit (Human) (OKEH02315) |
OKEH02315 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL |
Phospholipase D1 (PLD1) Antibody (HRP) |
20-abx316197 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase D1 (PLD1) Antibody (FITC) |
20-abx316198 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase D1 (PLD1) Antibody (Biotin) |
20-abx316199 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-PLD1/Phospholipase D1 Antibody |
A02031 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for PHOSPHOLIPASE D1/PLD1 detection. Tested for IHC in Human, Mouse, Rat. |
Anti-Phospholipase D1/PLD1 Antibody |
PB9380 |
BosterBio |
100ug/vial |
EUR 294 |
Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit |
GA-E0804HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit |
GA-E0804HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit |
201-12-0788 |
SunredBio |
96 tests |
EUR 440 |
- This phosphoinositide-specific phospholipase C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit |
CN-04440H1 |
ChemNorm |
96T |
EUR 478 |
Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit |
CN-04440H2 |
ChemNorm |
48T |
EUR 329 |
Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit |
QY-E02264 |
Qayee Biotechnology |
96T |
EUR 400 |
Human CCND1/ G1/S-specific cyclin-D1 ELISA Kit |
E0393Hu |
Sunlong |
1 Kit |
EUR 571 |
G1/S-specific cyclin-D1(CCND1) (Human) ELISA Kit |
E4287-100 |
Biovision |
|
EUR 805 |
Human CCND1(G1/S-specific cyclin-D1) ELISA Kit |
EH0970 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P24385
- Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human G1/S- specific cyclin- D1, CCND1 ELISA KIT |
ELI-02098h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat Phosphoinositide specific phospholipase C ELISA kit |
E02P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phosphoinositide specific phospholipase C ELISA kit |
E02P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phosphoinositide specific phospholipase C ELISA kit |
E02P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoinositide specific phospholipase C ELISA kit |
E03P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoinositide specific phospholipase C ELISA kit |
E03P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoinositide specific phospholipase C ELISA kit |
E03P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phosphoinositide specific phospholipase C ELISA kit |
E04P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phosphoinositide specific phospholipase C ELISA kit |
E04P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phosphoinositide specific phospholipase C ELISA kit |
E04P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoinositide specific phospholipase C ELISA kit |
E06P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoinositide specific phospholipase C ELISA kit |
E06P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoinositide specific phospholipase C ELISA kit |
E06P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoinositide specific phospholipase C ELISA kit |
E07P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoinositide specific phospholipase C ELISA kit |
E07P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoinositide specific phospholipase C ELISA kit |
E07P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoinositide specific phospholipase C ELISA kit |
E08P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoinositide specific phospholipase C ELISA kit |
E08P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoinositide specific phospholipase C ELISA kit |
E08P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoinositide specific phospholipase C ELISA kit |
E09P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoinositide specific phospholipase C ELISA kit |
E09P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoinositide specific phospholipase C ELISA kit |
E09P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D |
EK3272 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids. |
Guinea pig Phosphoinositide specific phospholipase C ELISA kit |
E05P0664-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Phosphoinositide specific phospholipase C ELISA kit |
E05P0664-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Phosphoinositide specific phospholipase C ELISA kit |
E05P0664-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
GPLD1 ELISA Kit (Bovine) (OKEH03927) |
OKEH03927 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL |
Mouse Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit |
E0235Mo |
Sunlong |
1 Kit |
EUR 571 |
ELISA kit for Rat G1/S-specific cyclin-D1 |
EK1987 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat G1/S-specific cyclin-D1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Bovine G1/S- specific cyclin- D1, CCND1 ELISA KIT |
ELI-02101b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse G1/S- specific cyclin- D1, Ccnd1 ELISA KIT |
ELI-02102m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken G1/S- specific cyclin- D1, CCND1 ELISA KIT |
ELI-02103c |
Lifescience Market |
96 Tests |
EUR 928 |
Rat Ccnd1(G1/S-specific cyclin-D1) ELISA Kit |
ER0328 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P39948
- Alias: Ccnd1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml |
Mouse CCND1(G1/S-specific cyclin-D1) ELISA Kit |
EM0414 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P25322
- Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/PRAD1B-cell CLL/lymphoma 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Bovine CCND1/ G1/S-specific cyclin-D1 ELISA Kit |
E0054Bo |
Sunlong |
1 Kit |
EUR 717 |
Rat Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit |
E0173Ra |
Sunlong |
1 Kit |
EUR 571 |
Human G1/S-specific cyclin-D1 (CCND1) |
1-CSB-EP004811HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 37.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human G1/S-specific cyclin-D1(CCND1) expressed in E.coli |
Ccnd1 ELISA Kit| Rat G1/S-specific cyclin-D1 ELISA Kit |
EF017201 |
Lifescience Market |
96 Tests |
EUR 689 |
CCND1 ELISA Kit| Mouse G1/S-specific cyclin-D1 ELISA Kit |
EF013067 |
Lifescience Market |
96 Tests |
EUR 689 |
Human PLCγ2(Phospholipase C Gamma 2, Phosphatidylinositol Specific) ELISA Kit |
EH3615 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P16885
- Alias: PLCγ2/PLCG2/Phosphoinositide phospholipase C-gamma-2/phospholipase C gamma 2/phospholipase C, gamma 2(phosphatidylinositol-specific)/phospholipase C, gamma 2(phosphatidylyinositol-specific)/P
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
20-abx152775 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Phospholipase C Beta 1, Phosphoinositide Specific (PLCB1) ELISA Kit |
abx251153-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx253002-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
DLR-PLCg2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
DLR-PLCg2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
RD-PLCg2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
RD-PLCg2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
RDR-PLCg2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
RDR-PLCg2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
SED841Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
SED841Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
SED841Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
SED841Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-A
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids. |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit |
4-SED841Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Phospholipase C Gamma 2, Phosphatidylinositol Specific elisa. Alternative names of the recognized antigen: PLC-IV
- Phosphoinositide phospholipase C-gamma-2
- 1-phosphatidylinositol 4, 5-bisphosphate phosphodiesterase gamma-2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Polyclonal PLD1 / Phospholipase D1 Antibody (aa527-576) |
AMR09364G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLD1 / Phospholipase D1 (aa527-576). This antibody is tested and proven to work in the following applications: |
Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody |
20-abx012716 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Phospholipase D1 Phospho-Ser561 (PLD1 pS561) Antibody |
20-abx326718 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody |
20-abx327761 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
G1 / S-specific cyclin-D1 Antibody |
abx018121-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Nicotiana alata Flower-specific defensin (D1) |
1-CSB-EP814081NDF |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 21.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Nicotiana alata Flower-specific defensin(D1) expressed in E.coli |
ELISA kit for Bovine Phosphatidylinositol-glycan-specific phospholipase D |
EK3273 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
GPLD1 siRNA |
20-abx918384 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPLD1 siRNA |
20-abx918385 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPLD1 antibody |
39044-100ul |
SAB |
100ul |
EUR 252 |
GPLD1 Antibody |
DF9750 |
Affbiotech |
200ul |
EUR 304 |
Description: GPLD1 Antibody detects endogenous levels of total GPLD1. |
GPLD1 Antibody |
1-CSB-PA009721LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
anti-GPLD1 |
YF-PA12100 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to GPLD1 |
anti-GPLD1 |
YF-PA12101 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GPLD1 |
Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored |
EF015079 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Phosphatidylinositol- glycan- specific phospholipase D, GP |
ELI-37994h |
Lifescience Market |
96 Tests |
EUR 824 |
Recombinant human Phosphatidylinositol-glycan-specific phospholipase D |
P1476 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P80108
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Phosphatidylinositol-glycan-specific phospholipase D |
Human Cyclin D1 ELISA kit |
E01C0483-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin D1 ELISA kit |
E01C0483-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin D1 ELISA kit |
E01C0483-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Resolvin D1 ELISA kit |
E01R0474-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Resolvin D1 ELISA kit |
E01R0474-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Resolvin D1 ELISA kit |
E01R0474-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin-D1 ELISA Kit |
201-12-1637 |
SunredBio |
96 tests |
EUR 440 |
- This Cyclin-D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Cyclin-D1 ELISA Kit |
CN-03559H1 |
ChemNorm |
96T |
EUR 476 |
Human Cyclin-D1 ELISA Kit |
CN-03559H2 |
ChemNorm |
48T |
EUR 326 |
ELISA kit for Human PLCg2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific) |
ELK3787 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLC?2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
- Show more
|
Description: A sandwich ELISA kit for detection of Phospholipase C Gamma 2, Phosphatidylinositol Specific from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human GPLD1 shRNA Plasmid |
20-abx951887 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monkey Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit |
abx360344-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx361179-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit |
abx362040-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx362856-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit |
abx363285-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx364145-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Chicken Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx355885-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit |
abx356854-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit |
abx359426-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Anti-HDAC6 Monoclonal Antibody (D1 domain-specific) |
A1485-100 |
Biovision |
|
EUR 370 |
Anti-HDAC6 Monoclonal Antibody (D1 domain-specific) |
A1486-100 |
Biovision |
|
EUR 370 |
Gpaa1 ELISA Kit| Mouse Glycosylphosphatidylinositol anchor atta |
EF015090 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific) |
E-EL-H0966 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PLC?2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLC?2. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific) in samples from Serum, Plasma, Cell supernatant |
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) CLIA Kit |
20-abx494409 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCγ2) CLIA Kit |
abx197465-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
GPLD1 Conjugated Antibody |
C39044 |
SAB |
100ul |
EUR 397 |
GPLD1 cloning plasmid |
CSB-CL009721HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 531
- Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc
- Show more
|
Description: A cloning plasmid for the GPLD1 gene. |
GPLD1 Rabbit pAb |
A6612-100ul |
Abclonal |
100 ul |
EUR 308 |
GPLD1 Rabbit pAb |
A6612-200ul |
Abclonal |
200 ul |
EUR 459 |
GPLD1 Rabbit pAb |
A6612-20ul |
Abclonal |
20 ul |
EUR 183 |
GPLD1 Rabbit pAb |
A6612-50ul |
Abclonal |
50 ul |
EUR 223 |
GPLD1 Blocking Peptide |
DF9750-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-GPLD1 antibody |
STJ28695 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
abx570812-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
20-abx151698 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit |
abx387626-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)ELISA Kit |
201-12-2723 |
SunredBio |
96 tests |
EUR 440 |
- This Glycosylphosphatidylinositol Anchored Molecule Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
DLR-GML-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
DLR-GML-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
RD-GML-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
RD-GML-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
RDR-GML-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
RDR-GML-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein(GML)ELISA Kit |
QY-E04903 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
SEG832Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intr
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
SEG832Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intr
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
SEG832Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intr
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
SEG832Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intr
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids. |
Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit |
4-SEG832Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Glycosylphosphatidylinositol Anchored Molecule Like Protein elisa. Alternative names of the recognized antigen: LY6DL
- GPI Anchored Molecule Like Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Cyclin D1 (CCND1) ELISA Kit |
abx571993-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Dopamine Receptor D1 ELISA kit |
E01D0044-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dopamine Receptor D1 ELISA kit |
E01D0044-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dopamine Receptor D1 ELISA kit |
E01D0044-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein Kinase D1 ELISA kit |
E01P0113-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein Kinase D1 ELISA kit |
E01P0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein Kinase D1 ELISA kit |
E01P0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Serpin D1 PicoKine ELISA Kit |
EK1968 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Serpin D1 in cell culture supernates, serum and plasma (EDTA, citrate) and urine. |
Human Cyclin D1 (CCND1) ELISA Kit |
20-abx151222 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Cyclin D1 (CCND1) ELISA Kit |
abx051526-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-10 working days.
|
Human Cyclin D1 (CCND1) ELISA Kit |
abx253925-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Plexin D1 (PLXND1)ELISA Kit |
201-12-2640 |
SunredBio |
96 tests |
EUR 440 |
- This Plexin D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |