Human GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1) ELISA Kit

Human GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-48Tests 48 Tests
EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-96Tests 96 Tests
EUR 756

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx129033
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx005070
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx172649
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

4-RPH975Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P80108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

20-abx151715
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx250820-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 ELISA Kit (GPLD1)

RK01496 96 Tests
EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

SEH975Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

4-SEH975Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycosylphosphatidylinositol Specific Phospholipase D1 elisa. Alternative names of the recognized antigen: GPIPLD
  • GPIPLDM
  • PIGPLD
  • PIGPLD1
  • Glycoprotein phospholipase D
  • Glycosyl-phosphatidylinositol-specific phospholipase D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein

20-abx168135
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx361319-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx362401-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx356152-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx359589-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit

abx195711-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) CLIA Kit

20-abx495589
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)

ELK3447 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
  • Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Specific Phospholipase D1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)

E-EL-H0397 1 plate of 96 wells
EUR 534
  • Gentaur's GPLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human)

4-PAH975Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

Guinea pig Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

abx357367-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)

E-CL-H0323 1 plate of 96 wells
EUR 584
  • Gentaur's GPLD1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC

4-PAH975Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Biotinylated

4-PAH975Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Biotin.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), Cy3

4-PAH975Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with Cy3.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), FITC

4-PAH975Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with FITC.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), HRP

4-PAH975Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with HRP.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), PE

4-PAH975Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with PE.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Polyclonal Antibody (Human), APC-Cy7

4-PAH975Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GPLD1 (Met496~Asp840)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). This antibody is labeled with APC-Cy7.

Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx573546-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E1050Hu 1 Kit
EUR 605

Human GPLD1(Phosphatidylinositol-glycan-specific phospholipase D) ELISA Kit

EH1534 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P80108
  • Alias: GPLD1(Glycosylphosphatidylinositol Specific Phospholipase D1)/GPIPLD/GPIPLDM/PIGPLD/PIGPLD1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit

CSB-EL009721HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) ELISA kit

1-CSB-EL009721HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phosphatidylinositol-glycan-specific phospholipase D(GPLD1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516609-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516611-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) ELISA Kit

abx516612-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Bovine GPLD1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E0302Bo 1 Kit
EUR 717

Mouse Gpld1/ Phosphatidylinositol-glycan-specific phospholipase D ELISA Kit

E1647Mo 1 Kit
EUR 632

Phospholipase D1, Phosphatidylcholine-Specific Antibody

20-abx114491
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-48T 48T
EUR 332
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1)

KTE61937-96T 96T
EUR 539
  • Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme.
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Phosphatidylinositol-glycan-specific phospholipase D (GPLD1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Phospholipase D1 ELISA kit

E01P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 ELISA kit

E01P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 ELISA kit

E01P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase D1 (PLD1) ELISA Kit

abx516744-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ELISA kit for Human Phospholipase D1

EK3334 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phospholipase D1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PLD1/ Phospholipase D1 ELISA Kit

E1961Hu 1 Kit
EUR 605

Human PLD1(Phospholipase D1) ELISA Kit

EH1563 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q13393
  • Alias: PLD1/Phospholipase D1/Choline phosphatase 1/hPLD1/Phosphatidylcholine-hydrolyzing phospholipase D1/phospholipase D1, phophatidylcholine-specific
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Phospholipase D1, PLD1 ELISA KIT

ELI-36375h 96 Tests
EUR 824

Human Phospholipase D1 (PLD1) ELISA Kit

abx250852-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Phospholipase D1 (PLD1)ELISA Kit

201-12-2641 96 tests
EUR 440
  • This Phospholipase D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Phospholipase D1(PLD1) ELISA kit

CSB-EL018144HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1 (PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Phospholipase D1(PLD1) ELISA kit

1-CSB-EL018144HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Phospholipase D1(PLD1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Phospholipase D1(PLD1)ELISA Kit

QY-E02288 96T
EUR 361

Rat Phospholipase D1 ELISA kit

E02P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase D1 ELISA kit

E02P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phospholipase D1 ELISA kit

E02P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit

E03P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit

E03P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phospholipase D1 ELISA kit

E03P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit

E04P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit

E04P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phospholipase D1 ELISA kit

E04P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit

E06P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit

E06P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phospholipase D1 ELISA kit

E06P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit

E07P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit

E07P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phospholipase D1 ELISA kit

E07P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit

E08P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit

E08P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phospholipase D1 ELISA kit

E08P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit

E09P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit

E09P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phospholipase D1 ELISA kit

E09P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human PLD1 (Phospholipase D1)

E-EL-H1595 1 plate of 96 wells
EUR 534
  • Gentaur's PLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLD1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLD1 (Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

anti-Phospholipase D1

YF-PA24392 50 ul
EUR 334
Description: Mouse polyclonal to Phospholipase D1

Mouse Phospholipase D1 (PLD1) ELISA Kit

abx516745-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Phospholipase D1 (PLD1) ELISA Kit

abx516746-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Guinea pig Phospholipase D1 ELISA kit

E05P0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phospholipase D1 ELISA kit

E05P0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phospholipase D1 ELISA kit

E05P0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Phospholipase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Pld1/ Phospholipase D1 ELISA Kit

E1153Mo 1 Kit
EUR 632

Mouse Phospholipase D1, Pld1 ELISA KIT

ELI-45228m 96 Tests
EUR 865

Pld1 ELISA Kit| Rat Phospholipase D1 ELISA Kit

EF019192 96 Tests
EUR 689

Pld1 ELISA Kit| Mouse Phospholipase D1 ELISA Kit

EF015900 96 Tests
EUR 689

Gpld1 ELISA Kit| Rat Phosphatidylinositol-glycan-specific phosp

EF018760 96 Tests
EUR 689

Gpld1 ELISA Kit| Mouse Phosphatidylinositol-glycan-specific pho

EF015080 96 Tests
EUR 689

GPLD1 ELISA Kit| Bovine Phosphatidylinositol-glycan-specific ph

EF011449 96 Tests
EUR 689

Human GPLD1 ELISA Kit

ELA-E13691h 96 Tests
EUR 824

GPLD1 ELISA KIT|Human

EF005585 96 Tests
EUR 689

Phospholipase D1 (PLD1) Antibody

20-abx326421
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody

20-abx326659
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody

20-abx217813
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody

abx236530-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Phospholipase D1 (PLD1) Antibody

20-abx301070
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Phospholipase D1 (2F3)

YF-MA14765 100 ug
EUR 363
Description: Mouse monoclonal to Phospholipase D1

Anti-Phospholipase D1 (10H2)

YF-MA14766 100 ug
EUR 363
Description: Mouse monoclonal to Phospholipase D1

Human Phosphoinositide specific phospholipase C ELISA kit

E01P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoinositide specific phospholipase C ELISA kit

E01P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphoinositide specific phospholipase C ELISA kit

E01P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human G1/S-specific Cyclin-D1 ELISA Kit

CSB-E08286h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human G1/S-specific Cyclin-D1 ELISA Kit

1-CSB-E08286h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human G1/S-specific Cyclin-D1 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

GPLD1 ELISA Kit (Human) (OKAN05580)

OKAN05580 96 Wells
EUR 792
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

GPLD1 ELISA Kit (Human) (OKCD09132)

OKCD09132 96 Wells
EUR 975
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL

GPLD1 ELISA Kit (Human) (OKEH02315)

OKEH02315 96 Wells
EUR 662
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

Phospholipase D1 (PLD1) Antibody (HRP)

20-abx316197
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody (FITC)

20-abx316198
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 (PLD1) Antibody (Biotin)

20-abx316199
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PLD1/Phospholipase D1 Antibody

A02031 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for PHOSPHOLIPASE D1/PLD1 detection. Tested for IHC in Human, Mouse, Rat.

Anti-Phospholipase D1/PLD1 Antibody

PB9380 100ug/vial
EUR 294

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit

GA-E0804HM-48T 48T
EUR 289

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit

GA-E0804HM-96T 96T
EUR 466

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit

201-12-0788 96 tests
EUR 440
  • This phosphoinositide-specific phospholipase C ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit

CN-04440H1 96T
EUR 478

Human phosphoinositide-specific phospholipase C,PIPLC ELISA Kit

CN-04440H2 48T
EUR 329

Human phosphoinositide-specific phospholipase C(PIPLC)ELISA Kit

QY-E02264 96T
EUR 400

Human CCND1/ G1/S-specific cyclin-D1 ELISA Kit

E0393Hu 1 Kit
EUR 571

G1/S-specific cyclin-D1(CCND1) (Human) ELISA Kit

E4287-100
EUR 805

Human CCND1(G1/S-specific cyclin-D1) ELISA Kit

EH0970 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P24385
  • Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human G1/S- specific cyclin- D1, CCND1 ELISA KIT

ELI-02098h 96 Tests
EUR 824

Rat Phosphoinositide specific phospholipase C ELISA kit

E02P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoinositide specific phospholipase C ELISA kit

E02P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphoinositide specific phospholipase C ELISA kit

E02P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit

E03P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit

E03P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphoinositide specific phospholipase C ELISA kit

E03P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit

E04P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit

E04P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphoinositide specific phospholipase C ELISA kit

E04P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit

E06P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit

E06P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphoinositide specific phospholipase C ELISA kit

E06P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit

E07P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit

E07P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphoinositide specific phospholipase C ELISA kit

E07P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit

E08P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit

E08P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphoinositide specific phospholipase C ELISA kit

E08P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit

E09P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit

E09P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphoinositide specific phospholipase C ELISA kit

E09P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Phosphatidylinositol-glycan-specific phospholipase D

EK3272 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit

E05P0664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit

E05P0664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphoinositide specific phospholipase C ELISA kit

E05P0664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphoinositide specific phospholipase C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GPLD1 ELISA Kit (Bovine) (OKEH03927)

OKEH03927 96 Wells
EUR 779
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL

Mouse Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit

E0235Mo 1 Kit
EUR 571

ELISA kit for Rat G1/S-specific cyclin-D1

EK1987 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat G1/S-specific cyclin-D1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Bovine G1/S- specific cyclin- D1, CCND1 ELISA KIT

ELI-02101b 96 Tests
EUR 928

Mouse G1/S- specific cyclin- D1, Ccnd1 ELISA KIT

ELI-02102m 96 Tests
EUR 865

Chicken G1/S- specific cyclin- D1, CCND1 ELISA KIT

ELI-02103c 96 Tests
EUR 928

Rat Ccnd1(G1/S-specific cyclin-D1) ELISA Kit

ER0328 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P39948
  • Alias: Ccnd1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/G1/S-specific cyclin D1/G1/S-specific cyclin-D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse CCND1(G1/S-specific cyclin-D1) ELISA Kit

EM0414 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P25322
  • Alias: CCND1/BCL-1/PRAD1 oncogene/B-cell lymphoma 1 protein/BCL-1 oncogene/BCL1/PRAD1/Cyclin-D1/Cyl-1/cyclin D1/PRAD1B-cell CLL/lymphoma 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Bovine CCND1/ G1/S-specific cyclin-D1 ELISA Kit

E0054Bo 1 Kit
EUR 717

Rat Ccnd1/ G1/S-specific cyclin-D1 ELISA Kit

E0173Ra 1 Kit
EUR 571

Human G1/S-specific cyclin-D1 (CCND1)

1-CSB-EP004811HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human G1/S-specific cyclin-D1(CCND1) expressed in E.coli

Ccnd1 ELISA Kit| Rat G1/S-specific cyclin-D1 ELISA Kit

EF017201 96 Tests
EUR 689

CCND1 ELISA Kit| Mouse G1/S-specific cyclin-D1 ELISA Kit

EF013067 96 Tests
EUR 689

Human PLCγ2(Phospholipase C Gamma 2, Phosphatidylinositol Specific) ELISA Kit

EH3615 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P16885
  • Alias: PLCγ2/PLCG2/Phosphoinositide phospholipase C-gamma-2/phospholipase C gamma 2/phospholipase C, gamma 2(phosphatidylinositol-specific)/phospholipase C, gamma 2(phosphatidylyinositol-specific)/P
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

20-abx152775
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Phospholipase C Beta 1, Phosphoinositide Specific (PLCB1) ELISA Kit

abx251153-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx253002-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

DLR-PLCg2-Hu-48T 48T
EUR 517
  • Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

DLR-PLCg2-Hu-96T 96T
EUR 673
  • Should the Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

RD-PLCg2-Hu-48Tests 48 Tests
EUR 521

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

RD-PLCg2-Hu-96Tests 96 Tests
EUR 723

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

RDR-PLCg2-Hu-48Tests 48 Tests
EUR 544

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

RDR-PLCg2-Hu-96Tests 96 Tests
EUR 756

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

SED841Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

SED841Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

SED841Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

SED841Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in Tissue homogenates, cell lysates and other biological fluids.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) ELISA Kit

4-SED841Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipase C Gamma 2, Phosphatidylinositol Specific elisa. Alternative names of the recognized antigen: PLC-IV
  • Phosphoinositide phospholipase C-gamma-2
  • 1-phosphatidylinositol 4, 5-bisphosphate phosphodiesterase gamma-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCg2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Polyclonal PLD1 / Phospholipase D1 Antibody (aa527-576)

AMR09364G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLD1 / Phospholipase D1 (aa527-576). This antibody is tested and proven to work in the following applications:

Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody

20-abx012716
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Phospholipase D1 Phospho-Ser561 (PLD1 pS561) Antibody

20-abx326718
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase D1 Phospho-Thr147 (PLD1 pT147) Antibody

20-abx327761
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G1 / S-specific cyclin-D1 Antibody

abx018121-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Nicotiana alata Flower-specific defensin (D1)

1-CSB-EP814081NDF
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Nicotiana alata Flower-specific defensin(D1) expressed in E.coli

ELISA kit for Bovine Phosphatidylinositol-glycan-specific phospholipase D

EK3273 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Phosphatidylinositol-glycan-specific phospholipase D in samples from serum, plasma, tissue homogenates and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

GPLD1 Antibody

ABD9750 100 ug
EUR 438

GPLD1 siRNA

20-abx918384
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 siRNA

20-abx918385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 antibody

39044-100ul 100ul
EUR 252

GPLD1 Antibody

DF9750 200ul
EUR 304
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

GPLD1 Antibody

1-CSB-PA009721LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-GPLD1

YF-PA12100 50 ul
EUR 363
Description: Mouse polyclonal to GPLD1

anti-GPLD1

YF-PA12101 50 ug
EUR 363
Description: Mouse polyclonal to GPLD1

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored

EF015079 96 Tests
EUR 689

Human Phosphatidylinositol- glycan- specific phospholipase D, GP

ELI-37994h 96 Tests
EUR 824

Recombinant human Phosphatidylinositol-glycan-specific phospholipase D

P1476 100ug Ask for price
  • Uniprot ID: P80108
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Phosphatidylinositol-glycan-specific phospholipase D

Human Cyclin D1 ELISA kit

E01C0483-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin D1 ELISA kit

E01C0483-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin D1 ELISA kit

E01C0483-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit

E01R0474-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit

E01R0474-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resolvin D1 ELISA kit

E01R0474-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Resolvin D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin-D1 ELISA Kit

GA-E1653HM-48T 48T
EUR 289

Human Cyclin-D1 ELISA Kit

GA-E1653HM-96T 96T
EUR 466

Human Cyclin-D1 ELISA Kit

201-12-1637 96 tests
EUR 440
  • This Cyclin-D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cyclin-D1 ELISA Kit

CN-03559H1 96T
EUR 476

Human Cyclin-D1 ELISA Kit

CN-03559H2 48T
EUR 326

Human Cyclin-D1 ELISA Kit

QY-E00939 96T
EUR 361

ELISA kit for Human PLCg2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific)

ELK3787 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLC?2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase C Gamma 2, Phosphatidylinositol Specific from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cyclin-D1/ Rat Cyclin- D1 ELISA Kit

ELA-E0585r 96 Tests
EUR 886

Human GPLD1 shRNA Plasmid

20-abx951887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monkey Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit

abx360344-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx361179-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit

abx362040-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx362856-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit

abx363285-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx364145-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Chicken Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx355885-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit

abx356854-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) ELISA Kit

abx359426-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Anti-HDAC6 Monoclonal Antibody (D1 domain-specific)

A1485-100
EUR 370

Anti-HDAC6 Monoclonal Antibody (D1 domain-specific)

A1486-100
EUR 370

Gpaa1 ELISA Kit| Mouse Glycosylphosphatidylinositol anchor atta

EF015090 96 Tests
EUR 689

ELISA kit for Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific)

E-EL-H0966 1 plate of 96 wells
EUR 534
  • Gentaur's PLC?2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PLC?2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PLC?2 (Phospholipase C Gamma 2, Phosphatidylinositol Specific) in samples from Serum, Plasma, Cell supernatant

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCG2) CLIA Kit

20-abx494409
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Phospholipase C Gamma 2, Phosphatidylinositol Specific (PLCγ2) CLIA Kit

abx197465-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

GPLD1 Conjugated Antibody

C39044 100ul
EUR 397

GPLD1 cloning plasmid

CSB-CL009721HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc
  • Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Rabbit pAb

A6612-100ul 100 ul
EUR 308

GPLD1 Rabbit pAb

A6612-200ul 200 ul
EUR 459

GPLD1 Rabbit pAb

A6612-20ul 20 ul
EUR 183

GPLD1 Rabbit pAb

A6612-50ul 50 ul
EUR 223

GPLD1 Blocking Peptide

DF9750-BP 1mg
EUR 195

Anti-GPLD1 antibody

STJ28695 100 µl
EUR 277
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

abx570812-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

20-abx151698
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit

abx387626-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)ELISA Kit

201-12-2723 96 tests
EUR 440
  • This Glycosylphosphatidylinositol Anchored Molecule Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

DLR-GML-Hu-48T 48T
EUR 517
  • Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

DLR-GML-Hu-96T 96T
EUR 673
  • Should the Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from tissue homogenates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RD-GML-Hu-48Tests 48 Tests
EUR 521

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RD-GML-Hu-96Tests 96 Tests
EUR 723

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RDR-GML-Hu-48Tests 48 Tests
EUR 544

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

RDR-GML-Hu-96Tests 96 Tests
EUR 756

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein(GML)ELISA Kit

QY-E04903 96T
EUR 361

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

SEG832Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intr
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit

4-SEG832Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Glycosylphosphatidylinositol Anchored Molecule Like Protein elisa. Alternative names of the recognized antigen: LY6DL
  • GPI Anchored Molecule Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Cyclin D1 (CCND1) ELISA Kit

abx571993-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Dopamine Receptor D1 ELISA kit

E01D0044-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine Receptor D1 ELISA kit

E01D0044-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dopamine Receptor D1 ELISA kit

E01D0044-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dopamine Receptor D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit

E01P0113-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit

E01P0113-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein Kinase D1 ELISA kit

E01P0113-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein Kinase D1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin D1 PicoKine ELISA Kit

EK1968 96 wells
EUR 425
Description: For quantitative detection of human Serpin D1 in cell culture supernates, serum and plasma (EDTA, citrate) and urine.

Human Plexin- D1, PLXND1 ELISA KIT

ELI-45235h 96 Tests
EUR 824

Human Cyclin D1 (CCND1) ELISA Kit

20-abx151222
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cyclin D1 (CCND1) ELISA Kit

abx051526-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Human Cyclin D1 (CCND1) ELISA Kit

abx253925-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Plexin D1 (PLXND1)ELISA Kit

201-12-2640 96 tests
EUR 440
  • This Plexin D1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.