Human TKT(Transketolase) ELISA Kit

Human TKT(Transketolase) ELISA Kit

To Order Contact us:

Human Transketolase (TKT) ELISA Kit

RD-TKT-Hu-96Tests 96 Tests
EUR 723

Rat Transketolase (TKT) ELISA Kit

DLR-TKT-Ra-48T 48T
EUR 549
  • Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit

DLR-TKT-Ra-96T 96T
EUR 718
  • Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit

RDR-TKT-Ra-48Tests 48 Tests
EUR 583

Rat Transketolase (TKT) ELISA Kit

RDR-TKT-Ra-96Tests 96 Tests
EUR 811

Rat Transketolase (TKT) ELISA Kit

RD-TKT-Ra-48Tests 48 Tests
EUR 557

Rat Transketolase (TKT) ELISA Kit

RD-TKT-Ra-96Tests 96 Tests
EUR 775

Human Transketolase (TKT) ELISA Kit

abx570798-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TKT/ Transketolase ELISA Kit

E2507Hu 1 Kit
EUR 571

Human Transketolase (TKT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transketolase ELISA Kit (TKT)

RK02393 96 Tests
EUR 521

Human Transketolase (TKT) ELISA Kit

SEH019Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
  • Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transketolase (TKT)

  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transketolase(TKT) expressed in E.coli

Cow Transketolase (TKT) ELISA Kit

abx511828-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Transketolase (TKT) ELISA Kit

abx511830-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Transketolase (TKT) ELISA Kit

abx573626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Bovine Transketolase, TKT ELISA Kit

ELA-E0113b 96 Tests
EUR 928

Mouse Transketolase, TKT ELISA Kit

ELA-E0113m 96 Tests
EUR 678

Rat Transketolase, TKT ELISA Kit

ELA-E0113r 96 Tests
EUR 678

Mouse Tkt/ Transketolase ELISA Kit

E1477Mo 1 Kit
EUR 571

Rat Transketolase (TKT) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
  • Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Transketolase (TKT) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human TKT (Transketolase)

ELK3271 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transketolase (TKT) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transketolase (TKT) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transketolase (TKT) Antibody

abx122017-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transketolase (TKT) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transketolase (TKT) Antibody

abx238938-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Transketolase (TKT) Antibody

abx238939-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transketolase (TKT) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Transketolase (TKT)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P29401
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Transketolase expressed in: E.coli

Recombinant Transketolase (TKT)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P50137
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.9kDa
  • Isoelectric Point: 7.1
Description: Recombinant Rat Transketolase expressed in: E.coli

Human Transketolase (TKT) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Transketolase (TKT) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rat TKT (Transketolase)

ELK7034 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-48T 48T
EUR 332
  • Transketolase (EC is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transketolase (EC is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-96T 96T
EUR 539
  • Transketolase (EC is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Transketolase (TKT) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Transketolase (TKT) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKT Transketolase Human Recombinant Protein

PROTP29401 Regular: 10ug
EUR 317
Description: TKT Human Recombinant produced in E. coli is a single polypeptide chain containing 643 amino acids (1-623) and having a molecular mass of 70.0kDa.;TKT is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Transketolase (TKT) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC-Cy7.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC-Cy7.

Human Transketolase ELISA kit

E01T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit

E01T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit

E01T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA Kit

ELA-E0113h 96 Tests
EUR 824

Transketolase ELISA KIT|Human

EF003792 96 Tests
EUR 689

TKT ELISA Kit (Human) (OKAN05459)

OKAN05459 96 Wells
EUR 792
Description: Description of target: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071 ng/mL

TKT ELISA Kit (Human) (OKCD09022)

OKCD09022 96 Wells
EUR 975
Description: Description of target: TKT belongs to the transketolase family. TKT has been implicated in the latent genetic disease Wernicke-Korsakoff syndrome (WKS), which causes specific brain damage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.071ng/mL

TKT ELISA Kit (Human) (OKEH03030)

OKEH03030 96 Wells
EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Mouse Transketolase ELISA kit

E03T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit

E03T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit

E03T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TKT ELISA Kit (Rat) (OKCD00704)

OKCD00704 96 Wells
EUR 896
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

TKT ELISA Kit (Mouse) (OKEH05920)

OKEH05920 96 Wells
EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

TKT ELISA Kit (Bovine) (OKEH07303)

OKEH07303 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


YF-PA15046 50 ug
EUR 363
Description: Mouse polyclonal to Transketolase


YF-PA15047 100 ul
EUR 403
Description: Rabbit polyclonal to Transketolase


YF-PA15048 100 ug
EUR 403
Description: Rabbit polyclonal to Transketolase


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TKT antibody

70R-20843 50 ul
EUR 435
Description: Rabbit polyclonal TKT antibody

TKT antibody

70R-2587 50 ug
EUR 467
Description: Rabbit polyclonal TKT antibody

TKT antibody

38817-100ul 100ul
EUR 252

TKT Antibody

42786-100ul 100ul
EUR 252

TKT antibody

10R-6070 100 ul
EUR 726
Description: Mouse monoclonal TKT antibody

TKT Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TKT Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TKT Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Human Transketolase- like protein 1, TKTL1 ELISA KIT

ELI-16212h 96 Tests
EUR 824

Human Transketolase- like protein 2, TKTL2 ELISA KIT

ELI-41847h 96 Tests
EUR 824

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transketolase-like protein 2 (TKTL2) ELISA Kit

abx385487-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-48T 48T
EUR 517
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-96T 96T
EUR 673
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RDR-TKTL1-Hu-48Tests 48 Tests
EUR 544

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RDR-TKTL1-Hu-96Tests 96 Tests
EUR 756

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RD-TKTL1-Hu-48Tests 48 Tests
EUR 521

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RD-TKTL1-Hu-96Tests 96 Tests
EUR 723

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase Like Protein 1 elisa. Alternative names of the recognized antigen: TKR
  • TKT2
  • TK 2
  • Transketolase-related protein
  • Transketolase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human TKT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TKT Recombinant Protein (Human)

RP031648 100 ug Ask for price

TKT Recombinant Protein (Human)

RP031651 100 ug Ask for price

anti- Transketolase antibody

FNab08938 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: transketolase
  • Uniprot ID: P29401
  • Gene ID: 7086
  • Research Area: Metabolism
Description: Antibody raised against Transketolase

anti- Transketolase antibody

FNab08939 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: transketolase
  • Uniprot ID: P29401
  • Gene ID: 7086
  • Research Area: Metabolism
Description: Antibody raised against Transketolase

Recombinant mouse Transketolase

P1406 100ug Ask for price
  • Uniprot ID: P40142
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Transketolase

Anti-Transketolase antibody

PAab08938 100 ug
EUR 386

ELISA kit for Human TKTL1 (Transketolase Like Protein 1)

ELK4675 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase Like Protein 1 (TKTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

TKT Conjugated Antibody

C38817 100ul
EUR 397

TKT cloning plasmid

CSB-CL023580HU1-10ug 10ug
EUR 633
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1872
  • Sequence: atggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctaca
  • Show more
Description: A cloning plasmid for the TKT gene.

TKT cloning plasmid

CSB-CL023580HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1374
  • Sequence: atggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccgctgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgt
  • Show more
Description: A cloning plasmid for the TKT gene.

TKT Polyclonal Antibody

ES11750-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Polyclonal Antibody

ES11750-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Enzyme (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

TKT Polyclonal Antibody

ABP60697-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TKT protein
  • Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Polyclonal Antibody

ABP60697-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TKT protein
  • Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Polyclonal Antibody

ABP60697-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TKT protein
  • Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Rabbit pAb

A6314-100ul 100 ul
EUR 308

TKT Rabbit pAb

A6314-200ul 200 ul
EUR 459

TKT Rabbit pAb

A6314-20ul 20 ul
EUR 183

TKT Rabbit pAb

A6314-50ul 50 ul
EUR 223

TKT Rabbit pAb

A13553-100ul 100 ul
EUR 308

TKT Rabbit pAb

A13553-200ul 200 ul
EUR 459

TKT Rabbit pAb

A13553-20ul 20 ul
EUR 183

TKT Rabbit pAb

A13553-50ul 50 ul
EUR 223

TKT Blocking Peptide

33R-2753 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TKT antibody, catalog no. 70R-2587

Anti-TKT antibody

STJ28236 100 µl
EUR 277
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TKT antibody

STJ115514 100 µl
EUR 277
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TKT antibody

STJ192908 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TKT

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

TKT ORF Vector (Human) (pORF)

ORF010550 1.0 ug DNA
EUR 95

TKT ORF Vector (Human) (pORF)

ORF010551 1.0 ug DNA
EUR 95

Tktl2 ELISA Kit| Mouse Transketolase-like protein 2 ELISA Kit

EF016417 96 Tests
EUR 689

TKTL2 ELISA Kit| Bovine Transketolase-like protein 2 ELISA Kit

EF011986 96 Tests
EUR 689

Bovine Transketolase- like protein 2, TKTL2 ELISA KIT

ELI-16213b 96 Tests
EUR 928

Mouse Transketolase- like protein 2, Tktl2 ELISA KIT

ELI-52128m 96 Tests
EUR 865

Bovine Transketolase- like protein 1, TKTL1 ELISA KIT

ELI-28947b 96 Tests
EUR 928

Mouse Transketolase- like protein 1, Tktl1 ELISA KIT

ELI-41846m 96 Tests
EUR 865

Mouse Transketolase-like protein 2 (TKTL2) ELISA Kit

abx390774-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Transketolase Like Protein 1 (TKTL1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat TKT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.