Human TKT(Transketolase) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Transketolase (TKT) ELISA Kit |
RD-TKT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Transketolase (TKT) ELISA Kit |
DLR-TKT-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
DLR-TKT-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
RDR-TKT-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Transketolase (TKT) ELISA Kit |
RDR-TKT-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Transketolase (TKT) ELISA Kit |
RD-TKT-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Transketolase (TKT) ELISA Kit |
RD-TKT-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Transketolase (TKT) ELISA Kit |
abx570798-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human TKT/ Transketolase ELISA Kit |
E2507Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Transketolase (TKT) ELISA Kit |
20-abx153380 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transketolase ELISA Kit (TKT) |
RK02393 |
Abclonal |
96 Tests |
EUR 521 |
Human Transketolase (TKT) ELISA Kit |
SEH019Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transketolase (TKT) ELISA Kit |
SEH019Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transketolase (TKT) ELISA Kit |
SEH019Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transketolase (TKT) ELISA Kit |
SEH019Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transketolase (TKT) ELISA Kit |
4-SEH019Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
- Wernicke-Korsakoff Syndrome
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Transketolase (TKT) |
1-CSB-EP023580HUe1 |
Cusabio |
-
EUR 621.00
-
EUR 381.00
-
EUR 1943.00
-
EUR 882.00
-
EUR 1335.00
-
EUR 451.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 67.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Transketolase(TKT) expressed in E.coli |
Cow Transketolase (TKT) ELISA Kit |
abx511828-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Transketolase (TKT) ELISA Kit |
abx511830-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Transketolase (TKT) ELISA Kit |
abx573626-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Tkt/ Transketolase ELISA Kit |
E1477Mo |
Sunlong |
1 Kit |
EUR 571 |
Rat Transketolase (TKT) ELISA Kit |
20-abx156184 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Transketolase (TKT) ELISA Kit |
SEH019Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
SEH019Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
SEH019Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
SEH019Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Transketolase (TKT) ELISA Kit |
4-SEH019Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
- Wernicke-Korsakoff Syndrome
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Transketolase (TKT) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human TKT (Transketolase) |
ELK3271 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
- Show more
|
Description: A sandwich ELISA kit for detection of Transketolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Transketolase (TKT) Antibody |
20-abx116203 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transketolase (TKT) Antibody |
20-abx129192 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 815.00
-
EUR 425.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transketolase (TKT) Antibody |
20-abx130403 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transketolase (TKT) Antibody |
abx122017-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Transketolase (TKT) Antibody |
20-abx142264 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Transketolase (TKT) Antibody |
20-abx004826 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Transketolase (TKT) Antibody |
20-abx174907 |
Abbexa |
|
|
|
Transketolase (TKT) Antibody |
20-abx174908 |
Abbexa |
|
|
|
Transketolase (TKT) Antibody |
abx238938-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Transketolase (TKT) Antibody |
abx238939-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Transketolase (TKT) Antibody |
20-abx241314 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transketolase (TKT) Antibody |
20-abx241315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Transketolase (TKT) |
4-RPH019Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P29401
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 36.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Transketolase expressed in: E.coli |
Recombinant Transketolase (TKT) |
4-RPH019Ra01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P50137
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.9kDa
- Isoelectric Point: 7.1
|
Description: Recombinant Rat Transketolase expressed in: E.coli |
Human Transketolase (TKT) CLIA Kit |
20-abx495353 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Transketolase (TKT) Protein |
20-abx166627 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Rat TKT (Transketolase) |
ELK7034 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
- Show more
|
Description: A sandwich ELISA kit for detection of Transketolase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Transketolase (TKT) |
KTE70217-48T |
Abbkine |
48T |
EUR 332 |
- Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transketolase (TKT) |
KTE70217-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transketolase (TKT) |
KTE70217-96T |
Abbkine |
96T |
EUR 539 |
- Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Transketolase (TKT) CLIA Kit |
20-abx495354 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Transketolase (TKT) Protein |
20-abx167617 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
TKT Transketolase Human Recombinant Protein |
PROTP29401 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: TKT Human Recombinant produced in E. coli is a single polypeptide chain containing 643 amino acids (1-623) and having a molecular mass of 70.0kDa.;TKT is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Transketolase (TKT) Polyclonal Antibody (Human) |
4-PAH019Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT) |
Transketolase (TKT) Polyclonal Antibody (Human), APC |
4-PAH019Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC. |
Transketolase (TKT) Polyclonal Antibody (Human), Biotinylated |
4-PAH019Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Biotin. |
Transketolase (TKT) Polyclonal Antibody (Human), Cy3 |
4-PAH019Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Cy3. |
Transketolase (TKT) Polyclonal Antibody (Human), FITC |
4-PAH019Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with FITC. |
Transketolase (TKT) Polyclonal Antibody (Human), HRP |
4-PAH019Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with HRP. |
Transketolase (TKT) Polyclonal Antibody (Human), PE |
4-PAH019Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with PE. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat) |
4-PAH019Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT) |
Transketolase (TKT) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH019Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Pro294)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC-Cy7. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC |
4-PAH019Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAH019Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Biotin. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAH019Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Cy3. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), FITC |
4-PAH019Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with FITC. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), HRP |
4-PAH019Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with HRP. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), PE |
4-PAH019Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with PE. |
Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAH019Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TKT (Met1~Lys286)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC-Cy7. |
Human Transketolase ELISA kit |
E01T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transketolase ELISA kit |
E01T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transketolase ELISA kit |
E01T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TKT ELISA Kit (Human) (OKAN05459) |
OKAN05459 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071 ng/mL |
TKT ELISA Kit (Human) (OKCD09022) |
OKCD09022 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: TKT belongs to the transketolase family. TKT has been implicated in the latent genetic disease Wernicke-Korsakoff syndrome (WKS), which causes specific brain damage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.071ng/mL |
TKT ELISA Kit (Human) (OKEH03030) |
OKEH03030 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
Mouse Transketolase ELISA kit |
E03T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transketolase ELISA kit |
E03T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Transketolase ELISA kit |
E03T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transketolase ELISA kit |
E02T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transketolase ELISA kit |
E02T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Transketolase ELISA kit |
E02T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transketolase ELISA kit |
E04T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transketolase ELISA kit |
E04T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Transketolase ELISA kit |
E04T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transketolase ELISA kit |
E08T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transketolase ELISA kit |
E08T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Transketolase ELISA kit |
E08T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transketolase ELISA kit |
E07T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transketolase ELISA kit |
E07T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Transketolase ELISA kit |
E07T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transketolase ELISA kit |
E06T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transketolase ELISA kit |
E06T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Transketolase ELISA kit |
E06T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transketolase ELISA kit |
E09T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transketolase ELISA kit |
E09T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Transketolase ELISA kit |
E09T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transketolase ELISA kit |
E05T0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transketolase ELISA kit |
E05T0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Transketolase ELISA kit |
E05T0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TKT ELISA Kit (Rat) (OKCD00704) |
OKCD00704 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL |
TKT ELISA Kit (Mouse) (OKEH05920) |
OKEH05920 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
TKT ELISA Kit (Bovine) (OKEH07303) |
OKEH07303 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
anti-Transketolase |
YF-PA15046 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Transketolase |
anti-Transketolase |
YF-PA15047 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to Transketolase |
anti-Transketolase |
YF-PA15048 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Transketolase |
TKT siRNA |
20-abx905591 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TKT siRNA |
20-abx936854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TKT siRNA |
20-abx936855 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TKT antibody |
70R-20843 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TKT antibody |
TKT antibody |
70R-2587 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TKT antibody |
TKT antibody |
38817-100ul |
SAB |
100ul |
EUR 252 |
TKT Antibody |
42786-100ul |
SAB |
100ul |
EUR 252 |
TKT antibody |
10R-6070 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal TKT antibody |
TKT Antibody |
1-CSB-PA570820 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TKT Antibody |
1-CSB-PA023580GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
TKT Antibody |
1-CSB-PA025245 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Human Transketolase- like protein 1, TKTL1 ELISA KIT |
ELI-16212h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transketolase- like protein 2, TKTL2 ELISA KIT |
ELI-41847h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
20-abx153312 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transketolase-like protein 2 (TKTL2) ELISA Kit |
abx385487-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
DLR-TKTL1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
DLR-TKTL1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
RDR-TKTL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
RDR-TKTL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
RD-TKTL1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
RD-TKTL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
SEH018Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
SEH018Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
SEH018Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
SEH018Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Transketolase Like Protein 1 (TKTL1) ELISA Kit |
4-SEH018Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transketolase Like Protein 1 elisa. Alternative names of the recognized antigen: TKR
- TKT2
- TK 2
- Transketolase-related protein
- Transketolase 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human TKT shRNA Plasmid |
20-abx954853 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TKT Recombinant Protein (Human) |
RP031648 |
ABM |
100 ug |
Ask for price |
TKT Recombinant Protein (Human) |
RP031651 |
ABM |
100 ug |
Ask for price |
anti- Transketolase antibody |
FNab08938 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: transketolase
- Uniprot ID: P29401
- Gene ID: 7086
- Research Area: Metabolism
|
Description: Antibody raised against Transketolase |
anti- Transketolase antibody |
FNab08939 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: transketolase
- Uniprot ID: P29401
- Gene ID: 7086
- Research Area: Metabolism
|
Description: Antibody raised against Transketolase |
Recombinant mouse Transketolase |
P1406 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P40142
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for mouse Transketolase |
ELISA kit for Human TKTL1 (Transketolase Like Protein 1) |
ELK4675 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase Like Protein 1 (TKTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Transketolase Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
TKT Conjugated Antibody |
C38817 |
SAB |
100ul |
EUR 397 |
TKT cloning plasmid |
CSB-CL023580HU1-10ug |
Cusabio |
10ug |
EUR 633 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1872
- Sequence: atggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctaca
- Show more
|
Description: A cloning plasmid for the TKT gene. |
TKT cloning plasmid |
CSB-CL023580HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1374
- Sequence: atggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccgctgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgt
- Show more
|
Description: A cloning plasmid for the TKT gene. |
TKT Polyclonal Antibody |
ES11750-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TKT Polyclonal Antibody |
ES11750-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TKT Enzyme (Recombinant) |
20-abx073794 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
TKT Polyclonal Antibody |
ABP60697-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TKT protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein |
TKT Polyclonal Antibody |
ABP60697-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TKT protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein |
TKT Polyclonal Antibody |
ABP60697-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TKT protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein |
TKT Rabbit pAb |
A6314-100ul |
Abclonal |
100 ul |
EUR 308 |
TKT Rabbit pAb |
A6314-200ul |
Abclonal |
200 ul |
EUR 459 |
TKT Rabbit pAb |
A6314-20ul |
Abclonal |
20 ul |
EUR 183 |
TKT Rabbit pAb |
A6314-50ul |
Abclonal |
50 ul |
EUR 223 |
TKT Rabbit pAb |
A13553-100ul |
Abclonal |
100 ul |
EUR 308 |
TKT Rabbit pAb |
A13553-200ul |
Abclonal |
200 ul |
EUR 459 |
TKT Rabbit pAb |
A13553-20ul |
Abclonal |
20 ul |
EUR 183 |
TKT Rabbit pAb |
A13553-50ul |
Abclonal |
50 ul |
EUR 223 |
TKT Blocking Peptide |
33R-2753 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TKT antibody, catalog no. 70R-2587 |
Anti-TKT antibody |
STJ28236 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-TKT antibody |
STJ115514 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-TKT antibody |
STJ192908 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TKT |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
TKT ORF Vector (Human) (pORF) |
ORF010550 |
ABM |
1.0 ug DNA |
EUR 95 |
TKT ORF Vector (Human) (pORF) |
ORF010551 |
ABM |
1.0 ug DNA |
EUR 95 |
Tktl2 ELISA Kit| Mouse Transketolase-like protein 2 ELISA Kit |
EF016417 |
Lifescience Market |
96 Tests |
EUR 689 |
TKTL2 ELISA Kit| Bovine Transketolase-like protein 2 ELISA Kit |
EF011986 |
Lifescience Market |
96 Tests |
EUR 689 |
Bovine Transketolase- like protein 2, TKTL2 ELISA KIT |
ELI-16213b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Transketolase- like protein 2, Tktl2 ELISA KIT |
ELI-52128m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Transketolase- like protein 1, TKTL1 ELISA KIT |
ELI-28947b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Transketolase- like protein 1, Tktl1 ELISA KIT |
ELI-41846m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Transketolase-like protein 2 (TKTL2) ELISA Kit |
abx390774-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Transketolase Like Protein 1 (TKTL1) CLIA Kit |
20-abx495352 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat TKT shRNA Plasmid |
20-abx986273 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|