Human EMP3(Epithelial Membrane Protein 3) ELISA Kit

Human EMP3(Epithelial Membrane Protein 3) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

RDR-EMP3-Hu-96Tests 96 Tests
EUR 756

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

RD-EMP3-Hu-48Tests 48 Tests
EUR 521

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

RD-EMP3-Hu-96Tests 96 Tests
EUR 723

Human Epithelial Membrane Protein 3 (EMP3)ELISA Kit

201-12-2677 96 tests
EUR 440
  • This Epithelial Membrane Protein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

20-abx151403
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

abx257682-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human EMP3(Epithelial membrane protein 3) ELISA Kit

EH4978 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P54852
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Epithelial membrane protein 3, EMP3 ELISA KIT

ELI-09235h 96 Tests
EUR 824

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

20-abx585348
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Epithelial Membrane Protein 3(EMP3)ELISA Kit

QY-E04127 96T
EUR 361

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

SEJ157Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epithelial Membrane Protein 3 (EMP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epithelial Membrane Protein 3 (EMP3) in Tissue homogenates, cell Lysates and other biological fluids.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

SEJ157Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epithelial Membrane Protein 3 (EMP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epithelial Membrane Protein 3 (EMP3) in Tissue homogenates, cell Lysates and other biological fluids.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

SEJ157Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epithelial Membrane Protein 3 (EMP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epithelial Membrane Protein 3 (EMP3) in Tissue homogenates, cell Lysates and other biological fluids.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

SEJ157Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epithelial Membrane Protein 3 (EMP3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epithelial Membrane Protein 3 (EMP3) in Tissue homogenates, cell Lysates and other biological fluids.

Human Epithelial Membrane Protein 3 (EMP3) ELISA Kit

4-SEJ157Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Epithelial Membrane Protein 3 elisa. Alternative names of the recognized antigen: YMP
  • HNMP-1
  • Hematopoietic neural membrane protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epithelial Membrane Protein 3 (EMP3) in samples from Tissue homogenates, cell Lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Epithelial Membrane Protein 3 (EMP3) Protein

20-abx653303
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody

20-abx176309
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Epithelial Membrane Protein 3 (EMP3) Antibody

20-abx126894
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody

20-abx172279
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Epithelial Membrane Protein 3 (EMP3) Antibody

abx030475-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody

abx030475-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody

20-abx318509
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bovine Epithelial membrane protein 3, EMP3 ELISA KIT

ELI-09704b 96 Tests
EUR 928

Mouse Epithelial membrane protein 3, Emp3 ELISA KIT

ELI-32719m 96 Tests
EUR 865

Human Epithelial Membrane Protein 3 (EMP3) CLIA Kit

20-abx495627
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human EMP3 (Epithelial Membrane Protein 3)

ELK3422 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Epithelial Membrane Protein 3 (EMP3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Epithelial Membrane Protein 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Epithelial Membrane Protein 3 (EMP3) Antibody (HRP)

20-abx303720
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody (FITC)

20-abx303721
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 3 (EMP3) Antibody (Biotin)

20-abx303722
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Emp3/ Rat Emp3 ELISA Kit

ELI-31623r 96 Tests
EUR 886

Human EMP1/ Epithelial membrane protein 1 ELISA Kit

E0785Hu 1 Kit
EUR 605

Human Epithelial membrane protein 1, EMP1 ELISA KIT

ELI-09234h 96 Tests
EUR 824

Human Epithelial membrane protein 2, EMP2 ELISA KIT

ELI-09977h 96 Tests
EUR 824

Human Epithelial membrane protein 1 (EMP1) ELISA Kit

abx354367-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Epithelial Membrane Protein 1 (EMP1) ELISA Kit

20-abx384846
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Epithelial Membrane Protein 2 (EMP2) ELISA Kit

20-abx585347
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

EMP3 ELISA KIT|Human

EF007506 96 Tests
EUR 689

Human Epithelial membrane antigen,EMA ELISA Kit

201-12-1651 96 tests
EUR 440
  • This Epithelial membrane antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epithelial membrane antigen,EMA ELISA Kit

CN-04611H1 96T
EUR 434

Human Epithelial membrane antigen,EMA ELISA Kit

CN-04611H2 48T
EUR 284

Human Epithelial membrane antigen(EMA)ELISA Kit

GA-E1667HM-48T 48T
EUR 289

Human Epithelial membrane antigen(EMA)ELISA Kit

GA-E1667HM-96T 96T
EUR 466

Human Epithelial membrane antigen(EMA)ELISA Kit

QY-E01683 96T
EUR 361

Mouse Epithelial membrane protein 2, Emp2 ELISA KIT

ELI-27667m 96 Tests
EUR 865

Mouse Epithelial membrane protein 1 (EMP1) ELISA Kit

abx556063-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Epithelial membrane protein 1 (EPN3) ELISA Kit

abx556212-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Epithelial membrane protein 1, Emp1 ELISA KIT

ELI-32237m 96 Tests
EUR 865

Bovine Epithelial membrane protein 2, EMP2 ELISA KIT

ELI-47303b 96 Tests
EUR 928

Rabbit Epithelial membrane protein 1, EMP1 ELISA KIT

ELI-47620Ra 96 Tests
EUR 928

ELISA kit for Human Epithelial membrane antigen (EMA)

KTE61465-48T 48T
EUR 332
  • EMA encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Epithelial membrane antigen (EMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Epithelial membrane antigen (EMA)

KTE61465-5platesof96wells 5 plates of 96 wells
EUR 2115
  • EMA encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Epithelial membrane antigen (EMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Epithelial membrane antigen (EMA)

KTE61465-96T 96T
EUR 539
  • EMA encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Epithelial membrane antigen (EMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EMP3 ELISA Kit (Human) (OKCD01984)

OKCD01984 96 Wells
EUR 831
Description: Description of target: Probably involved in cell proliferation and cell-cell interactions. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

EMP-1 (Epithelial Membrane Protein)

5-01091 4 x 1mg Ask for price

Emp1 ELISA Kit| Rat Epithelial membrane protein 1 ELISA Kit

EF018641 96 Tests
EUR 689

Emp1 ELISA Kit| Mouse Epithelial membrane protein 1 ELISA Kit

EF014806 96 Tests
EUR 689

Pig Epithelial Membrane Antigen (MUC1) ELISA Kit

abx360587-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Epithelial Membrane Antigen (MUC1) ELISA Kit

abx364446-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

ELISA kit for Human Epithelial membrane protein 1,EMP-1

EK3297 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Epithelial membrane protein 1,EMP-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Nylon Membrane (30cmx3m)

D0157-3 1(30cmx3m), 1 UNIT
EUR 869.25
  • Product category: Labware/Filtration Supplies/Membrane Filters

EMP3 Recombinant Protein (Human)

RP010666 100 ug Ask for price

Epithelial Membrane Protein 2 (EMP2) Antibody

abx027480-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 2 (EMP2) Antibody

abx027480-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 2 (EMP2) Antibody

20-abx210948
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 2 (EMP2) Antibody

20-abx339293
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 1 (EMP1) Antibody

20-abx301180
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Cytokeratin, pan (Epithelial Marker) Antibody

M14209-3 100ug/vial
EUR 397
Description: Rabbit Polyclonal Cytokeratin, pan (Epithelial Marker) Antibody. Validated in IHC and tested in Human.

Epithelial Membrane Antigen (EMA) Antibody

abx022470-02mg 0.2 mg
EUR 940
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx023797-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx025382-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx025382-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020564-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020565-1mg 1 mg
EUR 801
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020566-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020567-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020569-1mg 1 mg
EUR 801
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx020571-1mg 1 mg
EUR 801
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

20-abx121644
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

20-abx123255
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

20-abx133246
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx235427-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Epithelial Membrane Antigen (MUC1) Antibody

abx235428-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Peroxisomal Membrane Protein 3 ELISA kit

E01P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Peroxisomal Membrane Protein 3 ELISA kit

E01P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Peroxisomal Membrane Protein 3 ELISA kit

E01P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Epithelial Membrane Protein 1 (EMP1) Antibody (HRP)

20-abx303717
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 1 (EMP1) Antibody (FITC)

20-abx303718
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Epithelial Membrane Protein 1 (EMP1) Antibody (Biotin)

20-abx303719
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EMP3 antibody

70R-12189 100 ug
EUR 403
Description: Rabbit polyclonal EMP3 antibody

EMP3 Antibody

1-CSB-PA007650LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EMP3. Recognizes EMP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200

EMP3 siRNA

20-abx901721
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EMP3 siRNA

20-abx915370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EMP3 siRNA

20-abx915371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-EMP3

YF-PA11556 100 ug
EUR 403
Description: Rabbit polyclonal to EMP3

anti-EMP3

YF-PA23644 50 ul
EUR 334
Description: Mouse polyclonal to EMP3

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

EMP3 Recombinant Protein (Rat)

RP199583 100 ug Ask for price

EMP3 Recombinant Protein (Mouse)

RP131672 100 ug Ask for price

EMP3 Recombinant Protein (Mouse)

RP131675 100 ug Ask for price

Epithelial Membrane Antigen; Clone E29 (Concentrate)

A00008-C 1 ml
EUR 497

Epithelial Membrane Antigen; Clone E29 (Concentrate)

A00008-C.1 0.1 ml
EUR 138

Epithelial Membrane Antigen (MUC1) Antibody Pair

abx117512-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Human EMP3 shRNA Plasmid

20-abx951395
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Vesicle Associated Membrane Protein 3 ELISA kit

E01V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vesicle Associated Membrane Protein 3 ELISA kit

E01V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vesicle Associated Membrane Protein 3 ELISA kit

E01V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane Protein, Palmitoylated 3 (MPP3) ELISA Kit

abx381505-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EMP3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0679204 1.0 ug DNA
EUR 154

Recombinant Human MMP-3 Protein

PROTP08254-3 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-3 degrades fibronectin, laminin, collagens III, IV, and X, and cartilage proteoglycans. Recombinant human MMP-3 is a 42.8 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (378 amino acids).

Rat Peroxisomal Membrane Protein 3 ELISA kit

E02P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Peroxisomal Membrane Protein 3 ELISA kit

E02P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Peroxisomal Membrane Protein 3 ELISA kit

E02P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Peroxisomal Membrane Protein 3 ELISA kit

E04P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Peroxisomal Membrane Protein 3 ELISA kit

E04P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Peroxisomal Membrane Protein 3 ELISA kit

E04P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Peroxisomal Membrane Protein 3 ELISA kit

E03P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Peroxisomal Membrane Protein 3 ELISA kit

E03P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Peroxisomal Membrane Protein 3 ELISA kit

E03P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Peroxisomal Membrane Protein 3 ELISA kit

E08P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Peroxisomal Membrane Protein 3 ELISA kit

E08P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Peroxisomal Membrane Protein 3 ELISA kit

E08P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Peroxisomal Membrane Protein 3 ELISA kit

E06P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Peroxisomal Membrane Protein 3 ELISA kit

E06P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Peroxisomal Membrane Protein 3 ELISA kit

E06P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Peroxisomal Membrane Protein 3 ELISA kit

E07P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Peroxisomal Membrane Protein 3 ELISA kit

E07P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Peroxisomal Membrane Protein 3 ELISA kit

E07P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Peroxisomal Membrane Protein 3 ELISA kit

E09P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Peroxisomal Membrane Protein 3 ELISA kit

E09P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Peroxisomal Membrane Protein 3 ELISA kit

E09P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

EMP3 Rabbit pAb

A11580-100ul 100 ul
EUR 308

EMP3 Rabbit pAb

A11580-200ul 200 ul
EUR 459

EMP3 Rabbit pAb

A11580-20ul 20 ul Ask for price

EMP3 Rabbit pAb

A11580-50ul 50 ul Ask for price

EMP3 Blocking Peptide

33R-10997 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EMP3 antibody, catalog no. 70R-12189

EMP3 cloning plasmid

CSB-CL007650HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 492
  • Sequence: atgtcactcctcttgctggtggtctcagcccttcacatcctcattcttatactgcttttcgtggccactttggacaagtcctggtggactctccctgggaaagagtccctgaatctctggtacgactgcacgtggaacaacgacaccaaaacatgggcctgcagtaatgtcagcga
  • Show more
Description: A cloning plasmid for the EMP3 gene.

EMP3 Polyclonal Antibody

A62470 100 µg
EUR 570.55
Description: Ask the seller for details

pCMV-SPORT6-EMP3

PVT12872 2 ug
EUR 391

Anti-EMP3 antibody

STJ113185 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the PMP-22/EMP/MP20 family of proteins. The protein contains four transmembrane domains and two N-linked glycosylation sites. It is thought to be involved in cell proliferation, cell-cell interactions and function as a tumor suppressor. Alternative splicing results in multiple transcript variants.

Anti-EMP3 (3D4)

YF-MA10273 100 ug
EUR 363
Description: Mouse monoclonal to EMP3

Anti-EMP3 (2C4)

YF-MA12836 100 ug
EUR 363
Description: Mouse monoclonal to EMP3

Human Erythrocyte membrane protein ELISA kit

E01E0150-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Erythrocyte membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Erythrocyte membrane protein ELISA kit

E01E0150-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Erythrocyte membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Erythrocyte membrane protein ELISA kit

E01E0150-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Erythrocyte membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human PMP3 (Peroxisomal Membrane Protein 3)

E-EL-H1358 1 plate of 96 wells
EUR 534
  • Gentaur's PMP3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PMP3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PMP3 (Peroxisomal Membrane Protein 3) in samples from Serum, Plasma, Cell supernatant

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

DLR-VAMP3-Hu-48T 48T
EUR 517
  • Should the Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vesicle-Associated Membrane Protein 3 (VAMP3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

DLR-VAMP3-Hu-96T 96T
EUR 673
  • Should the Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vesicle-Associated Membrane Protein 3 (VAMP3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Vesicle- associated membrane protein 3, VAMP3 ELISA KIT

ELI-51172h 96 Tests
EUR 824

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

abx392168-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lysosomal Associated Membrane Protein 3 (LAMP3) ELISA Kit

abx388222-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

RDR-VAMP3-Hu-48Tests 48 Tests
EUR 544

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

RDR-VAMP3-Hu-96Tests 96 Tests
EUR 756

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

RD-VAMP3-Hu-48Tests 48 Tests
EUR 521

Human Vesicle-Associated Membrane Protein 3 (VAMP3) ELISA Kit

RD-VAMP3-Hu-96Tests 96 Tests
EUR 723

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

Human Cadherin, Epithelial ELISA kit

E01C0624-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cadherin, Epithelial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin, Epithelial ELISA kit

E01C0624-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cadherin, Epithelial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin, Epithelial ELISA kit

E01C0624-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cadherin, Epithelial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL-3 Interleukin-3 Human Recombinant Protein, His Tag

PROTP08700-3 Regular: 50ug
EUR 317
Description: Interleukin-3 Human Recombinant produced in E.Coli is single, a non-glycosylated, Polypeptide chain containing 154 amino acids fragment (20-152) and having a total molecular mass of 17.3kDa and fused with a 20 aa N-terminal His tag. ;The IL3 His is purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

EMP3 ORF Vector (Human) (pORF)

ORF003556 1.0 ug DNA
EUR 95

EMP3 Protein Vector (Human) (pPB-C-His)

PV014221 500 ng
EUR 329

EMP3 Protein Vector (Human) (pPB-N-His)

PV014222 500 ng
EUR 329

EMP3 Protein Vector (Human) (pPM-C-HA)

PV014223 500 ng
EUR 329

EMP3 Protein Vector (Human) (pPM-C-His)

PV014224 500 ng
EUR 329

Rat Vesicle Associated Membrane Protein 3 ELISA kit

E02V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vesicle Associated Membrane Protein 3 ELISA kit

E02V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vesicle Associated Membrane Protein 3 ELISA kit

E02V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vesicle Associated Membrane Protein 3 ELISA kit

E04V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vesicle Associated Membrane Protein 3 ELISA kit

E04V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vesicle Associated Membrane Protein 3 ELISA kit

E04V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vesicle Associated Membrane Protein 3 ELISA kit

E03V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vesicle Associated Membrane Protein 3 ELISA kit

E03V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vesicle Associated Membrane Protein 3 ELISA kit

E03V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Peroxisomal Membrane Protein 3 ELISA kit

E05P0132-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Peroxisomal Membrane Protein 3 ELISA kit

E05P0132-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Peroxisomal Membrane Protein 3 ELISA kit

E05P0132-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Peroxisomal Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle Associated Membrane Protein 3 ELISA kit

E08V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle Associated Membrane Protein 3 ELISA kit

E08V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle Associated Membrane Protein 3 ELISA kit

E08V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle Associated Membrane Protein 3 ELISA kit

E06V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle Associated Membrane Protein 3 ELISA kit

E06V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle Associated Membrane Protein 3 ELISA kit

E06V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle Associated Membrane Protein 3 ELISA kit

E07V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle Associated Membrane Protein 3 ELISA kit

E07V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle Associated Membrane Protein 3 ELISA kit

E07V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle Associated Membrane Protein 3 ELISA kit

E09V0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle Associated Membrane Protein 3 ELISA kit

E09V0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle Associated Membrane Protein 3 ELISA kit

E09V0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle Associated Membrane Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse PMP3(Peroxisomal Membrane Protein 3) ELISA Kit

EM1300 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P55098
  • Alias: PEX2/PAF-1/PAF1/PMP3/PMP35/PXMP3/RNF72/RING finger protein 72/Peroxisome assembly factor 1/Peroxisomal membrane protein 3/35 kDa peroxisomal membrane protein/Peroxin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat PMP3(Peroxisomal Membrane Protein 3) ELISA Kit

ER1279 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: PMP3/PEX2/PAF-1/PAF1/PMP35/PXMP3/RNF72/RING finger protein 72/Peroxisome assembly factor 1/Peroxisomal membrane protein 3/35 kDa peroxisomal membrane protein/Peroxin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

PMP3 ELISA Kit| Rat Peroxisomal Membrane Protein 3 ELISA Kit

EF017991 96 Tests
EUR 689

PMP3 ELISA Kit| Mouse Peroxisomal Membrane Protein 3 ELISA Kit

EF013841 96 Tests
EUR 689

PLGF3 Human, Placenta Growth Factor-3 Human Recombinant Protein, sf9

PROTP49763-3 Regular: 25ug
EUR 317
Description: PLGF3 Human Recombinant produced in Spodoptera frugiperda is a glycosylated homodimer containing 2 chains of 203 amino acids (Leu19-Arg221) and having a molecular mass of 58kDa.;The PLGF-3 is purified by proprietary chromatographic techniques.

Human Membrane IgA ELISA kit

E01M0284-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane IgA ELISA kit

E01M0284-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane IgA ELISA kit

E01M0284-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane IgM ELISA kit

E01M0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane IgM ELISA kit

E01M0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane IgM ELISA kit

E01M0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane IgM in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human membrane cofactor protein,MCP ELISA Kit

201-12-0276 96 tests
EUR 440
  • This membrane cofactor protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human erythrocyte membrane protein,EMP ELISA Kit

201-12-1163 96 tests
EUR 440
  • This erythrocyte membrane protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Membrane Cofactor Protein (MCP) ELISA Kit

DLR-MCP-Hu-48T 48T
EUR 498
  • Should the Human Membrane Cofactor Protein (MCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Membrane Cofactor Protein (MCP) in samples from serum, plasma, urine, saliva or other biological fluids.

Human Membrane Cofactor Protein (MCP) ELISA Kit

DLR-MCP-Hu-96T 96T
EUR 647
  • Should the Human Membrane Cofactor Protein (MCP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Membrane Cofactor Protein (MCP) in samples from serum, plasma, urine, saliva or other biological fluids.

Human Major outer membrane protein ELISA kit

E01M0280-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Major outer membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Major outer membrane protein ELISA kit

E01M0280-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Major outer membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Major outer membrane protein ELISA kit

E01M0280-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Major outer membrane protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane cofactor protein(CD46) ELISA kit

E01M0374-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane cofactor protein(CD46) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane cofactor protein(CD46) ELISA kit

E01M0374-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane cofactor protein(CD46) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane cofactor protein(CD46) ELISA kit

E01M0374-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Membrane cofactor protein(CD46) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD46/ Membrane cofactor protein ELISA Kit

E0427Hu 1 Kit
EUR 571

Human Latent membrane protein 1 ELISA kit

E01L0243-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Latent membrane protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Latent membrane protein 1 ELISA kit

E01L0243-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Latent membrane protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Latent membrane protein 1 ELISA kit

E01L0243-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Latent membrane protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Membrane Cofactor Protein (MCP) ELISA Kit

20-abx152290
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Membrane Cofactor Protein (CD46) ELISA Kit

abx250731-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.