Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit

Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Hu-96Tests 96 Tests
EUR 723
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Hu-48Tests 48 Tests
EUR 544
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Hu-96Tests 96 Tests
EUR 756
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
DLR-PPOX-Ra-48T 48T
EUR 549
  • Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
DLR-PPOX-Ra-96T 96T
EUR 718
  • Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Ra-48Tests 48 Tests
EUR 557
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Ra-96Tests 96 Tests
EUR 775
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Ra-48Tests 48 Tests
EUR 583
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Ra-96Tests 96 Tests
EUR 811
Human Protoporphyrinogen oxidase (PPOX)
1-CSB-EP018502HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protoporphyrinogen oxidase(PPOX) expressed in E.coli
Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit
EH3640 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50336
  • Alias: PPOX/Orexin/Hypocretin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Protoporphyrinogen oxidase, PPOX ELISA KIT
ELI-19719h 96 Tests
EUR 824
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
20-abx152811
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx253030-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
4-SEF960Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP
  • PPO
  • V290M
  • Variegate Porphyria
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx114904
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx128342
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx130412
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx141854
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
abx036113-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx004892
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx174306
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx174307
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx178190
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Protoporphyrinogen Oxidase (PPOX) Antibody
abx236693-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx302943
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx212522
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx213025
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Protoporphyrinogen Oxidase (PPOX)
4-RPF960Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P50336
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 79.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Protoporphyrinogen Oxidase expressed in: E.coli
Recombinant Protoporphyrinogen Oxidase (PPOX)
4-RPF960Ra01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZVN7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Protoporphyrinogen Oxidase expressed in: E.coli
Pig Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx360628-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx363710-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT
ELI-36548m 96 Tests
EUR 865
Bovine Protoporphyrinogen oxidase, PPOX ELISA KIT
ELI-45677b 96 Tests
EUR 928
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
20-abx155999
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Monkey Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx359069-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx355834-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
4-SEF960Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP
  • PPO
  • V290M
  • Variegate Porphyria
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Protoporphyrinogen Oxidase (PPOX) Protein
20-abx168104
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit
20-abx495062
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit
abx197612-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Human PPOX (Protoporphyrinogen Oxidase)
ELK3418 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human PPOX (Protoporphyrinogen Oxidase)
E-EL-H1096 1 plate of 96 wells
EUR 534
  • Gentaur's PPOX ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant
Rat Protoporphyrinogen Oxidase (PPOX) Protein
20-abx168499
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody (HRP)
20-abx304930
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody (FITC)
20-abx304931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protoporphyrinogen Oxidase (PPOX) Antibody (Biotin)
20-abx304932
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Protoporphyrinogen Oxidase (PPOX) CLIA Kit
20-abx495063
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Rat PPOX (Protoporphyrinogen Oxidase)
ELK6244 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-48T 48T
EUR 332
  • PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-96T 96T
EUR 539
  • PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human)
4-PAF960Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX)
CLIA kit for Human PPOX (Protoporphyrinogen Oxidase)
E-CL-H0735 1 plate of 96 wells
EUR 584
  • Gentaur's PPOX CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat)
4-PAF960Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX)
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC
4-PAF960Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Biotinylated
4-PAF960Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Cy3
4-PAF960Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), FITC
4-PAF960Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), HRP
4-PAF960Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), PE
4-PAF960Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC
4-PAF960Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Biotinylated
4-PAF960Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Cy3
4-PAF960Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), FITC
4-PAF960Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), HRP
4-PAF960Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), PE
4-PAF960Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC-Cy7
4-PAF960Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Ile12~Leu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7.
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC-Cy7
4-PAF960Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PPOX (Gly9~Ala300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7.
PPOX ELISA KIT|Human
EF007104 96 Tests
EUR 689
PPOX ELISA Kit (Human) (OKCD08866)
OKCD08866 96 Wells
EUR 975
Description: Description of target: PPOX catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX..This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL
PPOX ELISA Kit (Human) (OKDD00479)
OKDD00479 96 Wells
EUR 975
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.053 ng/mL
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-100ug
QP6521-ec-100ug 100ug
EUR 408
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-10ug
QP6521-ec-10ug 10ug
EUR 200
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-1mg
QP6521-ec-1mg 1mg
EUR 1632
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-200ug
QP6521-ec-200ug 200ug
EUR 634
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-500ug
QP6521-ec-500ug 500ug
EUR 1060
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-50ug
QP6521-ec-50ug 50ug
EUR 263
PPOX ELISA Kit (Rat) (OKCD08867)
OKCD08867 96 Wells
EUR 1053
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL
PPOX ELISA Kit (Rat) (OKDD00682)
OKDD00682 96 Wells
EUR 1040
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
PPOX siRNA
20-abx929451
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPOX siRNA
20-abx929452
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PPOX antibody
70R-5301 50 ug
EUR 467
Description: Rabbit polyclonal PPOX antibody raised against the N terminal of PPOX
PPOX antibody
38877-100ul 100ul
EUR 252
PPOX Antibody
37844-100ul 100ul
EUR 252
PPOX antibody
70R-19466 50 ul
EUR 435
Description: Rabbit polyclonal PPOX antibody
PPOX Antibody
1-CSB-PA118443
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
PPOX Antibody
1-CSB-PA121495
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
PPOX Antibody
1-CSB-PA018502GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PPOX Antibody
1-CSB-PA018502LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
anti-PPOX
YF-PA13925 50 ul
EUR 363
Description: Mouse polyclonal to PPOX
anti-PPOX
YF-PA13926 100 ug
EUR 403
Description: Rabbit polyclonal to PPOX
Human PPOX shRNA Plasmid
20-abx953683
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PPOX Recombinant Protein (Human)
RP024328 100 ug Ask for price
PPOX Conjugated Antibody
C37844 100ul
EUR 397
PPOX Conjugated Antibody
C38877 100ul
EUR 397
PPOX cloning plasmid
CSB-CL018502HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1434
  • Sequence: atgggccggaccgtggtcgtgctgggcggaggcatcagcggcttggccgccagttaccacctgagccgggccccctgcccccctaaggtggtcctagtggagagcagtgagcgtctgggaggctggattcgctccgttcgaggccctaatggtgctatctttgagcttggacctc
  • Show more
Description: A cloning plasmid for the PPOX gene.
anti- PPOX antibody
FNab06693 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: protoporphyrinogen oxidase
  • Uniprot ID: P50336
  • Gene ID: 5498
  • Research Area: Metabolism
Description: Antibody raised against PPOX
PPOX Rabbit pAb
A6397-100ul 100 ul
EUR 308
PPOX Rabbit pAb
A6397-200ul 200 ul
EUR 459
PPOX Rabbit pAb
A6397-20ul 20 ul
EUR 183
PPOX Rabbit pAb
A6397-50ul 50 ul
EUR 223
PPOX Polyclonal Antibody
A63198 100 µg
EUR 570.55
Description: Ask the seller for details
PPOX Blocking Peptide
33R-8796 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPOX antibody, catalog no. 70R-5301
Anti-PPOX antibody
PAab06693 100 ug
EUR 386
Anti-PPOX antibody
STJ28480 100 µl
EUR 277
Description: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-PPOX (2C10)
YF-MA14834 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (2F12)
YF-MA14835 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (2B5)
YF-MA14836 50 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (2B5)
YF-MA14837 200 ul
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (3C10)
YF-MA14838 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (1E1)
YF-MA14839 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (1G2)
YF-MA14840 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (3H5)
YF-MA14841 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (2B7)
YF-MA14842 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
Anti-PPOX (2F10)
YF-MA10712 100 ug
EUR 363
Description: Mouse monoclonal to PPOX
PPOX ORF Vector (Human) (pORF)
ORF008110 1.0 ug DNA
EUR 95
Human Xanthione oxidase ELISA kit
E01X0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Xanthione oxidase ELISA kit
E01X0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Xanthione oxidase ELISA kit
E01X0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Diamine Oxidase ELISA kit
E01D0032-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Diamine Oxidase ELISA kit
E01D0032-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Diamine Oxidase ELISA kit
E01D0032-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lysyl oxidase ELISA kit
E01L0305-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lysyl oxidase ELISA kit
E01L0305-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Lysyl oxidase ELISA kit
E01L0305-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine Oxidase ELISA kit
E01M0224-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine Oxidase ELISA kit
E01M0224-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine Oxidase ELISA kit
E01M0224-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glucose Oxidase ELISA kit
E01G0341-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glucose Oxidase ELISA kit
E01G0341-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Glucose Oxidase ELISA kit
E01G0341-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human glucose oxidase ELISA Kit
ELA-E1439h 96 Tests
EUR 824
Human Sulfite Oxidase ELISA Kit
ELA-E2113h 96 Tests
EUR 824
Coproporphyrinogen oxidase ELISA KIT|Human
EF008795 96 Tests
EUR 689
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Mouse PPOX shRNA Plasmid
20-abx972167
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PPOX Antibody, HRP conjugated
1-CSB-PA018502LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PPOX Antibody, FITC conjugated
1-CSB-PA018502LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PPOX Antibody, Biotin conjugated
1-CSB-PA018502LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PPOX Recombinant Protein (Rat)
RP221678 100 ug Ask for price
PPOX Recombinant Protein (Mouse)
RP163838 100 ug Ask for price
PPOX sgRNA CRISPR Lentivector set (Human)
K1701601 3 x 1.0 ug
EUR 339
Human Spermine oxidase (SMOX) ELISA Kit
abx572451-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Glucose Oxidase (GOD) ELISA Kit
abx573186-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome c oxidase ELISA kit
E01C0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome c oxidase ELISA kit
E01C0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome c oxidase ELISA kit
E01C0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome Oxidase 4 ELISA kit
E01C0103-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome Oxidase 4 ELISA kit
E01C0103-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome Oxidase 4 ELISA kit
E01C0103-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine oxidase A ELISA kit
E01M0225-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine oxidase A ELISA kit
E01M0225-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Monoamine oxidase A ELISA kit
E01M0225-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acetyl CoA oxidase ELISA kit
E01A0641-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acetyl CoA oxidase ELISA kit
E01A0641-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acetyl CoA oxidase ELISA kit
E01A0641-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Human Spermine oxidase
EK4454 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Aldehyde oxidase
EK4704 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aldehyde oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.
Human NADPH oxidase 5 ELISA Kit
EH4125 96T
EUR 524.1
  • Detection range: 25-1600 pg/ml
  • Uniprot ID: Q96PH1
  • Alias: MGC149776/MGC149777/NOX5A/NOX5B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 7.18pg/ml
Human CPOX(Coproporphyrinogen oxidase) ELISA Kit
EH7555 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human SMOX/ Spermine oxidase ELISA Kit
E2348Hu 1 Kit
EUR 571
Human AOX1_/ Aldehyde oxidase ELISA Kit
E2879Hu 1 Kit
EUR 605
QuickDetect? Glucose Oxidase (Human) ELISA Kit
E4447-100
EUR 588
Human SMOX(Spermine oxidase) ELISA Kit
EH2188 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q9NWM0
  • Alias: SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml
Human AOX1(Aldehyde oxidase) ELISA Kit
EH2332 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q06278
  • Alias: AOX1/aldehyde oxidase/Azaheterocycle hydroxylase/aldehyde oxidase 1/AOAOH1/EC 1.2.3.1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Human LOX(Lysyl Oxidase) ELISA Kit
EH3299 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P28300
  • Alias: LOX/Protein-Lysine 6-Oxidase/MGC105112/Lysyl oxidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Human Sulfite oxidase, SUOX ELISA KIT
ELI-06780h 96 Tests
EUR 824
Human Spermine oxidase, SMOX ELISA KIT
ELI-07251h 96 Tests
EUR 824
Human Aldehyde oxidase, AOX1 ELISA KIT
ELI-07562h 96 Tests
EUR 824
Human glucose oxidase(GOD)ELISA Kit
GA-E0767HM-48T 48T
EUR 289
Human glucose oxidase(GOD)ELISA Kit
GA-E0767HM-96T 96T
EUR 466
Human monoamine oxidase(MAO)ELISA Kit
GA-E0791HM-48T 48T
EUR 289
Human monoamine oxidase(MAO)ELISA Kit
GA-E0791HM-96T 96T
EUR 466
Human diamine oxidase(DAO)ELISA Kit
GA-E0793HM-48T 48T
EUR 289
Human diamine oxidase(DAO)ELISA Kit
GA-E0793HM-96T 96T
EUR 466
Human Lathosterol oxidase, SC5DL ELISA KIT
ELI-40859h 96 Tests
EUR 824
Human Glucose Oxidase (GOD) ELISA Kit
20-abx151675
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Lysyl Oxidase (LOX) ELISA Kit
20-abx152252
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Spermine Oxidase (SMOX) ELISA Kit
20-abx153151
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Sulfite Oxidase (SUOX) ELISA Kit
20-abx153190
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Lysyl Oxidase (LOX) ELISA Kit
20-abx258747
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Xanthine Oxidase (XOD) ELISA Kit
abx352388-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Coproporphyrinogen Oxidase (CPOX) ELISA Kit
abx386630-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Spermine oxidase (SMOX) ELISA Kit
abx251528-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human Lysyl Oxidase (LOX) ELISA Kit
abx252702-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human glucose oxidase,GOD ELISA Kit
201-12-0751 96 tests
EUR 440
  • This glucose oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human monoamine oxidase,MAO ELISA Kit
201-12-0775 96 tests
EUR 440
  • This monoamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human diamine oxidase,DAO ELISA Kit
201-12-0777 96 tests
EUR 440
  • This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Hu-48T 48T
EUR 517
  • Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Hu-96T 96T
EUR 673
  • Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.