Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RD-PPOX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RDR-PPOX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RDR-PPOX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
DLR-PPOX-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
DLR-PPOX-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RD-PPOX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RD-PPOX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RDR-PPOX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
RDR-PPOX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Protoporphyrinogen oxidase (PPOX) |
1-CSB-EP018502HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Protoporphyrinogen oxidase(PPOX) expressed in E.coli |
Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit |
EH3640 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P50336
- Alias: PPOX/Orexin/Hypocretin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Protoporphyrinogen oxidase, PPOX ELISA KIT |
ELI-19719h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
20-abx152811 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
abx253030-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
4-SEF960Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP
- PPO
- V290M
- Variegate Porphyria
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx114904 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx128342 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx130412 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx141854 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
abx036113-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx004892 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx174306 |
Abbexa |
|
|
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx174307 |
Abbexa |
|
|
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx178190 |
Abbexa |
|
|
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
abx236693-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx302943 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx212522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody |
20-abx213025 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Protoporphyrinogen Oxidase (PPOX) |
4-RPF960Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P50336
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 79.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Protoporphyrinogen Oxidase expressed in: E.coli |
Recombinant Protoporphyrinogen Oxidase (PPOX) |
4-RPF960Ra01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZVN7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Protoporphyrinogen Oxidase expressed in: E.coli |
Pig Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
abx360628-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
abx363710-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT |
ELI-36548m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Protoporphyrinogen oxidase, PPOX ELISA KIT |
ELI-45677b |
Lifescience Market |
96 Tests |
EUR 928 |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
20-abx155999 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Monkey Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
abx359069-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
abx355834-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
SEF960Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids. |
Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit |
4-SEF960Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP
- PPO
- V290M
- Variegate Porphyria
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protoporphyrinogen Oxidase (PPOX) Protein |
20-abx168104 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit |
20-abx495062 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit |
abx197612-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Human PPOX (Protoporphyrinogen Oxidase) |
ELK3418 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human PPOX (Protoporphyrinogen Oxidase) |
E-EL-H1096 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PPOX ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant |
Rat Protoporphyrinogen Oxidase (PPOX) Protein |
20-abx168499 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody (HRP) |
20-abx304930 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody (FITC) |
20-abx304931 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protoporphyrinogen Oxidase (PPOX) Antibody (Biotin) |
20-abx304932 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat Protoporphyrinogen Oxidase (PPOX) CLIA Kit |
20-abx495063 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Rat PPOX (Protoporphyrinogen Oxidase) |
ELK6244 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
- Show more
|
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX) |
KTE70704-48T |
Abbkine |
48T |
EUR 332 |
- PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX) |
KTE70704-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX) |
KTE70704-96T |
Abbkine |
96T |
EUR 539 |
- PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human) |
4-PAF960Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX) |
CLIA kit for Human PPOX (Protoporphyrinogen Oxidase) |
E-CL-H0735 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's PPOX CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat) |
4-PAF960Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX) |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC |
4-PAF960Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Biotinylated |
4-PAF960Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Cy3 |
4-PAF960Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), FITC |
4-PAF960Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), HRP |
4-PAF960Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), PE |
4-PAF960Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC |
4-PAF960Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Biotinylated |
4-PAF960Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Cy3 |
4-PAF960Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), FITC |
4-PAF960Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), HRP |
4-PAF960Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), PE |
4-PAF960Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF960Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Ile12~Leu471)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7. |
Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAF960Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PPOX (Gly9~Ala300)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7. |
PPOX ELISA Kit (Human) (OKCD08866) |
OKCD08866 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: PPOX catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX..This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL |
PPOX ELISA Kit (Human) (OKDD00479) |
OKDD00479 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.053 ng/mL |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-100ug |
QP6521-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-10ug |
QP6521-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-1mg |
QP6521-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-200ug |
QP6521-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-500ug |
QP6521-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-50ug |
QP6521-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
PPOX ELISA Kit (Rat) (OKCD08867) |
OKCD08867 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL |
PPOX ELISA Kit (Rat) (OKDD00682) |
OKDD00682 |
Aviva Systems Biology |
96 Wells |
EUR 1040 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052 ng/mL |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
PPOX siRNA |
20-abx929451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPOX siRNA |
20-abx929452 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPOX antibody |
70R-5301 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PPOX antibody raised against the N terminal of PPOX |
PPOX antibody |
38877-100ul |
SAB |
100ul |
EUR 252 |
PPOX Antibody |
37844-100ul |
SAB |
100ul |
EUR 252 |
PPOX antibody |
70R-19466 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PPOX antibody |
PPOX Antibody |
1-CSB-PA118443 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
PPOX Antibody |
1-CSB-PA121495 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
PPOX Antibody |
1-CSB-PA018502GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PPOX Antibody |
1-CSB-PA018502LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
anti-PPOX |
YF-PA13925 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PPOX |
anti-PPOX |
YF-PA13926 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PPOX |
Human PPOX shRNA Plasmid |
20-abx953683 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PPOX Recombinant Protein (Human) |
RP024328 |
ABM |
100 ug |
Ask for price |
PPOX Conjugated Antibody |
C37844 |
SAB |
100ul |
EUR 397 |
PPOX Conjugated Antibody |
C38877 |
SAB |
100ul |
EUR 397 |
PPOX cloning plasmid |
CSB-CL018502HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1434
- Sequence: atgggccggaccgtggtcgtgctgggcggaggcatcagcggcttggccgccagttaccacctgagccgggccccctgcccccctaaggtggtcctagtggagagcagtgagcgtctgggaggctggattcgctccgttcgaggccctaatggtgctatctttgagcttggacctc
- Show more
|
Description: A cloning plasmid for the PPOX gene. |
anti- PPOX antibody |
FNab06693 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: protoporphyrinogen oxidase
- Uniprot ID: P50336
- Gene ID: 5498
- Research Area: Metabolism
|
Description: Antibody raised against PPOX |
PPOX Rabbit pAb |
A6397-100ul |
Abclonal |
100 ul |
EUR 308 |
PPOX Rabbit pAb |
A6397-200ul |
Abclonal |
200 ul |
EUR 459 |
PPOX Rabbit pAb |
A6397-20ul |
Abclonal |
20 ul |
EUR 183 |
PPOX Rabbit pAb |
A6397-50ul |
Abclonal |
50 ul |
EUR 223 |
PPOX Polyclonal Antibody |
A63198 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PPOX Blocking Peptide |
33R-8796 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPOX antibody, catalog no. 70R-5301 |
Anti-PPOX antibody |
STJ28480 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. |
Anti-PPOX (2C10) |
YF-MA14834 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (2F12) |
YF-MA14835 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (2B5) |
YF-MA14836 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (2B5) |
YF-MA14837 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (3C10) |
YF-MA14838 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (1E1) |
YF-MA14839 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (1G2) |
YF-MA14840 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (3H5) |
YF-MA14841 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (2B7) |
YF-MA14842 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
Anti-PPOX (2F10) |
YF-MA10712 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PPOX |
PPOX ORF Vector (Human) (pORF) |
ORF008110 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Xanthione oxidase ELISA kit |
E01X0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Xanthione oxidase ELISA kit |
E01X0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Xanthione oxidase ELISA kit |
E01X0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diamine Oxidase ELISA kit |
E01D0032-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diamine Oxidase ELISA kit |
E01D0032-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diamine Oxidase ELISA kit |
E01D0032-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lysyl oxidase ELISA kit |
E01L0305-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lysyl oxidase ELISA kit |
E01L0305-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Lysyl oxidase ELISA kit |
E01L0305-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine Oxidase ELISA kit |
E01M0224-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine Oxidase ELISA kit |
E01M0224-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine Oxidase ELISA kit |
E01M0224-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glucose Oxidase ELISA kit |
E01G0341-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glucose Oxidase ELISA kit |
E01G0341-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Glucose Oxidase ELISA kit |
E01G0341-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse PPOX shRNA Plasmid |
20-abx972167 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PPOX Antibody, HRP conjugated |
1-CSB-PA018502LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PPOX Antibody, FITC conjugated |
1-CSB-PA018502LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PPOX Antibody, Biotin conjugated |
1-CSB-PA018502LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PPOX Recombinant Protein (Rat) |
RP221678 |
ABM |
100 ug |
Ask for price |
PPOX Recombinant Protein (Mouse) |
RP163838 |
ABM |
100 ug |
Ask for price |
PPOX sgRNA CRISPR Lentivector set (Human) |
K1701601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Spermine oxidase (SMOX) ELISA Kit |
abx572451-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Glucose Oxidase (GOD) ELISA Kit |
abx573186-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Xanthine dehydrogenase/oxidase ELISA kit |
E01X0012-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Xanthine dehydrogenase/oxidase ELISA kit |
E01X0012-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Xanthine dehydrogenase/oxidase ELISA kit |
E01X0012-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome c oxidase ELISA kit |
E01C0015-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome c oxidase ELISA kit |
E01C0015-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome c oxidase ELISA kit |
E01C0015-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome Oxidase 4 ELISA kit |
E01C0103-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome Oxidase 4 ELISA kit |
E01C0103-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cytochrome Oxidase 4 ELISA kit |
E01C0103-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine oxidase A ELISA kit |
E01M0225-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine oxidase A ELISA kit |
E01M0225-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Monoamine oxidase A ELISA kit |
E01M0225-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldehyde oxidase(AOX1) ELISA kit |
E01A1553-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldehyde oxidase(AOX1) ELISA kit |
E01A1553-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Aldehyde oxidase(AOX1) ELISA kit |
E01A1553-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acetyl CoA oxidase ELISA kit |
E01A0641-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acetyl CoA oxidase ELISA kit |
E01A0641-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Acetyl CoA oxidase ELISA kit |
E01A0641-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Spermine oxidase |
EK4454 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Aldehyde oxidase |
EK4704 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aldehyde oxidase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human NADPH oxidase 5 ELISA Kit |
EH4125 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 25-1600 pg/ml
- Uniprot ID: Q96PH1
- Alias: MGC149776/MGC149777/NOX5A/NOX5B
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 7.18pg/ml |
Human CPOX(Coproporphyrinogen oxidase) ELISA Kit |
EH7555 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.313-20 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human SMOX/ Spermine oxidase ELISA Kit |
E2348Hu |
Sunlong |
1 Kit |
EUR 571 |
Human AOX1_/ Aldehyde oxidase ELISA Kit |
E2879Hu |
Sunlong |
1 Kit |
EUR 605 |
QuickDetect? Glucose Oxidase (Human) ELISA Kit |
E4447-100 |
Biovision |
|
EUR 588 |
Human SMOX(Spermine oxidase) ELISA Kit |
EH2188 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: Q9NWM0
- Alias: SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human AOX1(Aldehyde oxidase) ELISA Kit |
EH2332 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: Q06278
- Alias: AOX1/aldehyde oxidase/Azaheterocycle hydroxylase/aldehyde oxidase 1/AOAOH1/EC 1.2.3.1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human LOX(Lysyl Oxidase) ELISA Kit |
EH3299 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: P28300
- Alias: LOX/Protein-Lysine 6-Oxidase/MGC105112/Lysyl oxidase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human glucose oxidase(GOD)ELISA Kit |
GA-E0767HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human glucose oxidase(GOD)ELISA Kit |
GA-E0767HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human monoamine oxidase(MAO)ELISA Kit |
GA-E0791HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human monoamine oxidase(MAO)ELISA Kit |
GA-E0791HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human diamine oxidase(DAO)ELISA Kit |
GA-E0793HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human diamine oxidase(DAO)ELISA Kit |
GA-E0793HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Glucose Oxidase (GOD) ELISA Kit |
20-abx151675 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lysyl Oxidase (LOX) ELISA Kit |
20-abx152252 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Spermine Oxidase (SMOX) ELISA Kit |
20-abx153151 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Sulfite Oxidase (SUOX) ELISA Kit |
20-abx153190 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lysyl Oxidase (LOX) ELISA Kit |
20-abx258747 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Xanthine Oxidase (XOD) ELISA Kit |
abx352388-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Coproporphyrinogen Oxidase (CPOX) ELISA Kit |
abx386630-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Spermine oxidase (SMOX) ELISA Kit |
abx251528-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Lysyl Oxidase (LOX) ELISA Kit |
abx252702-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human glucose oxidase,GOD ELISA Kit |
201-12-0751 |
SunredBio |
96 tests |
EUR 440 |
- This glucose oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human monoamine oxidase,MAO ELISA Kit |
201-12-0775 |
SunredBio |
96 tests |
EUR 440 |
- This monoamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human diamine oxidase,DAO ELISA Kit |
201-12-0777 |
SunredBio |
96 tests |
EUR 440 |
- This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Polyamine Oxidase (PAOX) ELISA Kit |
DLR-PAOX-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Polyamine Oxidase (PAOX) ELISA Kit |
DLR-PAOX-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids. |