Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit

Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
DLR-PPOX-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
DLR-PPOX-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from tissue homogenates or other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RDR-PPOX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
RD-PPOX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Protoporphyrinogen oxidase (PPOX)
1-CSB-EP018502HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 66.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protoporphyrinogen oxidase(PPOX) expressed in E.coli

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
20-abx152811	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx253030-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PPOX(Protoporphyrinogen Oxidase) ELISA Kit
EH3640	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P50336 Alias: PPOX/Orexin/Hypocretin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protoporphyrinogen oxidase, PPOX ELISA KIT
ELI-19719h	Lifescience Market	96 Tests	EUR 824

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Human Protoporphyrinogen Oxidase (PPOX) ELISA Kit
4-SEF960Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP PPO V290M Variegate Porphyria
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx004892	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx178190	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx212522	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx213025	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx114904	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
abx036113-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx128342	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx130412	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx141854	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx174306	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx174307	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Protoporphyrinogen Oxidase (PPOX) Antibody
abx236693-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody
20-abx302943	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Protoporphyrinogen Oxidase (PPOX)
4-RPF960Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P50336 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 79.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Protoporphyrinogen Oxidase expressed in: E.coli

Recombinant Protoporphyrinogen Oxidase (PPOX)
4-RPF960Ra01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZVN7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.7kDa Isoelectric Point: Inquire
Description: Recombinant Rat Protoporphyrinogen Oxidase expressed in: E.coli

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
20-abx155999	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Bovine Protoporphyrinogen oxidase, PPOX ELISA KIT
ELI-45677b	Lifescience Market	96 Tests	EUR 928

Pig Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx360628-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx359069-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx355834-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Protoporphyrinogen Oxidase (PPOX) ELISA Kit
abx363710-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Protoporphyrinogen oxidase, Ppox ELISA KIT
ELI-36548m	Lifescience Market	96 Tests	EUR 865

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
SEF960Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Protoporphyrinogen Oxidase (PPOX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Protoporphyrinogen Oxidase (PPOX) in Tissue homogenates and other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) ELISA Kit
4-SEF960Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protoporphyrinogen Oxidase elisa. Alternative names of the recognized antigen: VP PPO V290M Variegate Porphyria
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Protoporphyrinogen Oxidase (PPOX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protoporphyrinogen Oxidase (PPOX) Protein
20-abx168104	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit
abx197612-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Protoporphyrinogen Oxidase (PPOX) CLIA Kit
20-abx495062	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PPOX (Protoporphyrinogen Oxidase)
E-EL-H1096	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PPOX ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PPOX (Protoporphyrinogen Oxidase)
ELK3418	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Protoporphyrinogen Oxidase (PPOX) Protein
20-abx168499	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody (HRP)
20-abx304930	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody (FITC)
20-abx304931	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protoporphyrinogen Oxidase (PPOX) Antibody (Biotin)
20-abx304932	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat Protoporphyrinogen Oxidase (PPOX) CLIA Kit
20-abx495063	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Rat PPOX (Protoporphyrinogen Oxidase)
ELK6244	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protoporphyrinogen Oxidase (PPOX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Show more
Description: A sandwich ELISA kit for detection of Protoporphyrinogen Oxidase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-48T	Abbkine	48T	EUR 332
PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protoporphyrinogen oxidase (PPOX)
KTE70704-96T	Abbkine	96T	EUR 539
PPOX is a human gene that produces an enzyme called protoporphyrinogen oxidase. This enzyme is responsible for the seventh step in heme production. Heme is the portion of hemoglobin that carries oxygen in the blood from the lungs to the rest of the b Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protoporphyrinogen oxidase (PPOX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human)
4-PAF960Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX)

CLIA kit for Human PPOX (Protoporphyrinogen Oxidase)
E-CL-H0735	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's PPOX CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PPOX . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human PPOX (Protoporphyrinogen Oxidase) in samples from Serum, Plasma, Cell supernatant

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat)
4-PAF960Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX)

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC
4-PAF960Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Biotinylated
4-PAF960Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), Cy3
4-PAF960Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), FITC
4-PAF960Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), HRP
4-PAF960Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), PE
4-PAF960Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC
4-PAF960Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Biotinylated
4-PAF960Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Biotin.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), Cy3
4-PAF960Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with Cy3.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), FITC
4-PAF960Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with FITC.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), HRP
4-PAF960Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with HRP.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), PE
4-PAF960Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with PE.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Human), APC-Cy7
4-PAF960Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Ile12~Leu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7.

Protoporphyrinogen Oxidase (PPOX) Polyclonal Antibody (Rat), APC-Cy7
4-PAF960Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PPOX (Gly9~Ala300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Protoporphyrinogen Oxidase (PPOX). This antibody is labeled with APC-Cy7.

PPOX ELISA KIT|Human
EF007104	Lifescience Market	96 Tests	EUR 689

PPOX ELISA Kit (Human) (OKCD08866)
OKCD08866	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: PPOX catalyzes the 6-electron oxidation of protoporphyrinogen-IX to form protoporphyrin-IX..This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL

PPOX ELISA Kit (Human) (OKDD00479)
OKDD00479	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.053 ng/mL

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-100ug
QP6521-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-10ug
QP6521-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-1mg
QP6521-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-200ug
QP6521-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-500ug
QP6521-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Protoporphyrinogen oxidase Protein, His-SUMO, E.coli-50ug
QP6521-ec-50ug	EnQuireBio	50ug	EUR 263

PPOX ELISA Kit (Rat) (OKCD08867)
OKCD08867	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.052ng/mL

PPOX ELISA Kit (Rat) (OKDD00682)
OKDD00682	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PPOX antibody
70R-19466	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PPOX antibody

PPOX Antibody
37844-100ul	SAB	100ul	EUR 252

PPOX antibody
38877-100ul	SAB	100ul	EUR 252

PPOX Antibody
1-CSB-PA118443	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PPOX Antibody
1-CSB-PA121495	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

PPOX antibody
70R-5301	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PPOX antibody raised against the N terminal of PPOX

PPOX Antibody
1-CSB-PA018502GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PPOX Antibody
1-CSB-PA018502LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

PPOX siRNA
20-abx929451	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PPOX siRNA
20-abx929452	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PPOX
YF-PA13925	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PPOX

anti-PPOX
YF-PA13926	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PPOX

Human PPOX shRNA Plasmid
20-abx953683	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PPOX Recombinant Protein (Human)
RP024328	ABM	100 ug	Ask for price

PPOX Blocking Peptide
33R-8796	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPOX antibody, catalog no. 70R-5301

PPOX Conjugated Antibody
C37844	SAB	100ul	EUR 397

PPOX Conjugated Antibody
C38877	SAB	100ul	EUR 397

PPOX cloning plasmid
CSB-CL018502HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1434 Sequence: atgggccggaccgtggtcgtgctgggcggaggcatcagcggcttggccgccagttaccacctgagccgggccccctgcccccctaaggtggtcctagtggagagcagtgagcgtctgggaggctggattcgctccgttcgaggccctaatggtgctatctttgagcttggacctc Show more
Description: A cloning plasmid for the PPOX gene.

PPOX Polyclonal Antibody
A63198	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PPOX Rabbit pAb
A6397-100ul	Abclonal	100 ul	EUR 308

PPOX Rabbit pAb
A6397-200ul	Abclonal	200 ul	EUR 459

PPOX Rabbit pAb
A6397-20ul	Abclonal	20 ul	EUR 183

PPOX Rabbit pAb
A6397-50ul	Abclonal	50 ul	EUR 223

anti- PPOX antibody
FNab06693	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: protoporphyrinogen oxidase Uniprot ID: P50336 Gene ID: 5498 Research Area: Metabolism
Description: Antibody raised against PPOX

Anti-PPOX antibody
PAab06693	Lifescience Market	100 ug	EUR 386

Anti-PPOX antibody
STJ28480	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified.

Anti-PPOX (2F10)
YF-MA10712	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (2C10)
YF-MA14834	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (2F12)
YF-MA14835	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (2B5)
YF-MA14836	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (2B5)
YF-MA14837	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (3C10)
YF-MA14838	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (1E1)
YF-MA14839	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (1G2)
YF-MA14840	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (3H5)
YF-MA14841	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

Anti-PPOX (2B7)
YF-MA14842	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PPOX

PPOX ORF Vector (Human) (pORF)
ORF008110	ABM	1.0 ug DNA	EUR 95

Human Lysyl oxidase ELISA kit
E01L0305-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lysyl oxidase ELISA kit
E01L0305-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lysyl oxidase ELISA kit
E01L0305-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Lysyl oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine Oxidase ELISA kit
E01M0224-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine Oxidase ELISA kit
E01M0224-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine Oxidase ELISA kit
E01M0224-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diamine Oxidase ELISA kit
E01D0032-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diamine Oxidase ELISA kit
E01D0032-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diamine Oxidase ELISA kit
E01D0032-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Diamine Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glucose Oxidase ELISA kit
E01G0341-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glucose Oxidase ELISA kit
E01G0341-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glucose Oxidase ELISA kit
E01G0341-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glucose Oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthione oxidase ELISA kit
E01X0001-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthione oxidase ELISA kit
E01X0001-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthione oxidase ELISA kit
E01X0001-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthione oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human glucose oxidase ELISA Kit
ELA-E1439h	Lifescience Market	96 Tests	EUR 824

Human Sulfite Oxidase ELISA Kit
ELA-E2113h	Lifescience Market	96 Tests	EUR 824

Coproporphyrinogen oxidase ELISA KIT|Human
EF008795	Lifescience Market	96 Tests	EUR 689

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse PPOX shRNA Plasmid
20-abx972167	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PPOX Antibody, HRP conjugated
1-CSB-PA018502LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPOX Antibody, FITC conjugated
1-CSB-PA018502LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PPOX Antibody, Biotin conjugated
1-CSB-PA018502LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPOX. Recognizes PPOX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PPOX Recombinant Protein (Mouse)
RP163838	ABM	100 ug	Ask for price

PPOX Recombinant Protein (Rat)
RP221678	ABM	100 ug	Ask for price

PPOX sgRNA CRISPR Lentivector set (Human)
K1701601	ABM	3 x 1.0 ug	EUR 339

Human glucose oxidase,GOD ELISA Kit
201-12-0751	SunredBio	96 tests	EUR 440
This glucose oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human monoamine oxidase,MAO ELISA Kit
201-12-0775	SunredBio	96 tests	EUR 440
This monoamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human diamine oxidase,DAO ELISA Kit
201-12-0777	SunredBio	96 tests	EUR 440
This diamine oxidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-Hu-48T	DL Develop	48T	EUR 479
Should the Human Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Diamine Oxidase (DAO) ELISA Kit
DLR-DAO-Hu-96T	DL Develop	96T	EUR 621
Should the Human Diamine Oxidase (DAO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diamine Oxidase (DAO) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Spermine Oxidase (SMOX) ELISA Kit
DLR-SMOX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Spermine Oxidase (SMOX) in samples from tissue homogenates or other biological fluids.

Human Spermine Oxidase (SMOX) ELISA Kit
DLR-SMOX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Spermine Oxidase (SMOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Spermine Oxidase (SMOX) in samples from tissue homogenates or other biological fluids.

Human Sulfite Oxidase (SUOX) ELISA Kit
DLR-SUOX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Sulfite Oxidase (SUOX) ELISA Kit
DLR-SUOX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sulfite Oxidase (SUOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfite Oxidase (SUOX) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Lysyl Oxidase (LOX) ELISA Kit
DLR-LOX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Lysyl Oxidase (LOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lysyl Oxidase (LOX) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Polyamine Oxidase (PAOX) ELISA Kit
DLR-PAOX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Polyamine Oxidase (PAOX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Polyamine Oxidase (PAOX) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glucose Oxidase (GOD) ELISA Kit
DLR-GOD-Hu-48T	DL Develop	48T	EUR 498
Should the Human Glucose Oxidase (GOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glucose Oxidase (GOD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glucose Oxidase (GOD) ELISA Kit
DLR-GOD-Hu-96T	DL Develop	96T	EUR 647
Should the Human Glucose Oxidase (GOD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glucose Oxidase (GOD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cytochrome c oxidase ELISA kit
E01C0015-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome c oxidase ELISA kit
E01C0015-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome c oxidase ELISA kit
E01C0015-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome c oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome Oxidase 4 ELISA kit
E01C0103-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome Oxidase 4 ELISA kit
E01C0103-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome Oxidase 4 ELISA kit
E01C0103-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome Oxidase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aldehyde oxidase(AOX1) ELISA kit
E01A1553-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Aldehyde oxidase(AOX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine oxidase A ELISA kit
E01M0225-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine oxidase A ELISA kit
E01M0225-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Monoamine oxidase A ELISA kit
E01M0225-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Monoamine oxidase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Xanthine dehydrogenase/oxidase ELISA kit
E01X0012-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Xanthine dehydrogenase/oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acetyl CoA oxidase ELISA kit
E01A0641-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acetyl CoA oxidase ELISA kit
E01A0641-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acetyl CoA oxidase ELISA kit
E01A0641-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acetyl CoA oxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glucose Oxidase (GOD) ELISA Kit
20-abx151675	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Lysyl Oxidase (LOX) ELISA Kit
20-abx152252	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Spermine Oxidase (SMOX) ELISA Kit
20-abx153151	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfite Oxidase (SUOX) ELISA Kit
20-abx153190	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Lysyl Oxidase (LOX) ELISA Kit
20-abx258747	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Spermine oxidase (SMOX) ELISA Kit
abx251528-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Lysyl Oxidase (LOX) ELISA Kit
abx252702-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human SMOX(Spermine oxidase) ELISA Kit
EH2188	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q9NWM0 Alias: SMOX(Spermine oxidase)Polyamine oxidase 1/PAO-1/PAOh1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human AOX1(Aldehyde oxidase) ELISA Kit
EH2332	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: Q06278 Alias: AOX1/aldehyde oxidase/Azaheterocycle hydroxylase/aldehyde oxidase 1/AOAOH1/EC 1.2.3.1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human LOX(Lysyl Oxidase) ELISA Kit
EH3299	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: P28300 Alias: LOX/Protein-Lysine 6-Oxidase/MGC105112/Lysyl oxidase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human NADPH oxidase 5 ELISA Kit
EH4125	FN Test	96T	EUR 524.1
Detection range: 25-1600 pg/ml Uniprot ID: Q96PH1 Alias: MGC149776/MGC149777/NOX5A/NOX5B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 7.18pg/ml

Human CPOX(Coproporphyrinogen oxidase) ELISA Kit
EH7555	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Spermine oxidase
EK4454	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Spermine oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Aldehyde oxidase
EK4704	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Aldehyde oxidase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SMOX/ Spermine oxidase ELISA Kit
E2348Hu	Sunlong	1 Kit	EUR 571

Human AOX1_/ Aldehyde oxidase ELISA Kit
E2879Hu	Sunlong	1 Kit	EUR 605

QuickDetect? Glucose Oxidase (Human) ELISA Kit
E4447-100	Biovision		EUR 588

Human Sulfite oxidase, SUOX ELISA KIT
ELI-06780h	Lifescience Market	96 Tests	EUR 824

Human Spermine oxidase, SMOX ELISA KIT
ELI-07251h	Lifescience Market	96 Tests	EUR 824

Human Aldehyde oxidase, AOX1 ELISA KIT
ELI-07562h	Lifescience Market	96 Tests	EUR 824

Human Xanthine Oxidase(XOD) ELISA Kit
CSB-E13124h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Xanthine Oxidase (XOD) in samples from serum, plasma, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.