Human MUTYH(MutY Homolog) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human MutY Homolog (MUTYH) ELISA Kit |
RDR-MUTYH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human MutY Homolog (MUTYH) ELISA Kit |
RDR-MUTYH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human MutY Homolog (MUTYH) ELISA Kit |
RD-MUTYH-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human MutY Homolog (MUTYH) ELISA Kit |
RD-MUTYH-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human MutY Homolog (MUTYH)ELISA Kit |
201-12-2943 |
SunredBio |
96 tests |
EUR 440 |
- This MutY Homolog ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human MutY Homolog (MUTYH) ELISA Kit |
20-abx152408 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human MutY Homolog (MUTYH) ELISA Kit |
SEJ746Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids. |
Human MutY Homolog (MUTYH) ELISA Kit |
SEJ746Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids. |
Human MutY Homolog (MUTYH) ELISA Kit |
SEJ746Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids. |
Human MutY Homolog (MUTYH) ELISA Kit |
SEJ746Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MutY Homolog (MUTYH) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MutY Homolog (MUTYH) in Tissue homogenates and other biological fluids. |
Human MutY Homolog (MUTYH) ELISA Kit |
4-SEJ746Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as MutY Homolog elisa. Alternative names of the recognized antigen: MYH
- A/G-specific adenine DNA glycosylase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MutY Homolog (MUTYH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
MutY Homolog (MUTYH) Antibody |
20-abx007479 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx210362 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx210393 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx113900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx131355 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx173642 |
Abbexa |
|
|
|
MutY Homolog (MUTYH) Antibody |
abx034253-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
abx034253-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx321559 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
abx235445-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
MutY Homolog (MUTYH) Antibody |
abx235446-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx329277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
abx432999-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx001356 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
MutY Homolog (MUTYH) Antibody |
20-abx001845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant MutY Homolog (MUTYH) |
4-RPJ746Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UIF7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human MutY Homolog expressed in: E.coli |
Human MutY Homolog (MUTYH) Protein |
20-abx650770 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human MutY Homolog (MUTYH) CLIA Kit |
20-abx495775 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human MUTYH (MutY Homolog) |
ELK3240 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to MutY Homolog (MUTYH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to MutY Homolog
- Show more
|
Description: A sandwich ELISA kit for detection of MutY Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human) |
4-PAJ746Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH) |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), APC |
4-PAJ746Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with APC. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), Biotinylated |
4-PAJ746Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with Biotin. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), Cy3 |
4-PAJ746Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with Cy3. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), FITC |
4-PAJ746Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with FITC. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), HRP |
4-PAJ746Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with HRP. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), PE |
4-PAJ746Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with PE. |
MutY Homolog (MUTYH) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ746Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MUTYH (Gly351~Ala544)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human MutY Homolog (MUTYH). This antibody is labeled with APC-Cy7. |
Human MutY homolog Control/blocking peptide #2 |
MUTY12-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
Rabbit Anti-Human MutY homolog peptide ab #2 |
MUTY12-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
MUTYH ELISA Kit (Human) (OKCD00581) |
OKCD00581 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Involved in oxidative DNA damage repair. Initiates repair of A*oxoG to C*G by removing the inappropriately paired adenine base from the DNA backbone. Possesses both adenine and 2-OH-A DNA glycosylase activities.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Identification of human MutY homolog (hMYH) as a repair enzyme for 2-hydroxyadenine in DNA and detection of multiple forms of hMYH located in nuclei and mitochondria."_x005F_x005F_x000D_Ohtsubo T., Nishioka K., Imaiso Y., Iwai S., Shimokawa H., Oda H., Fujikawa T., Nakabeppu Y._x005F_x005F_x000D_Nucleic Acids Res. 28:1355-1364(2000) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORMS ALPHA-1; ALPHA-2; ALPHA-3; BETA-1; GAMMA-2 AND GAMMA-3), FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL |
MUTYH ELISA Kit (Human) (OKDD00409) |
OKDD00409 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.041 ng/mL |
Rabbit Anti-Human MutY homolog peptide IgG #2, aff. Pure |
MUTY12-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MUTYH Antibody |
31101-100ul |
SAB |
100ul |
EUR 252 |
MUTYH Antibody |
31101-50ul |
SAB |
50ul |
EUR 187 |
MUTYH antibody |
70R-18684 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MUTYH antibody |
MUTYH antibody |
38267-100ul |
SAB |
100ul |
EUR 252 |
MUTYH Antibody |
1-CSB-PA003342 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
MUTYH Antibody |
1-CSB-PA883426ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
MUTYH Antibody |
DF6500 |
Affbiotech |
200ul |
EUR 304 |
Description: MUTYH Antibody detects endogenous levels of total MUTYH. |
MUTYH Antibody |
1-CSB-PA029874 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100 |
MUTYH Antibody |
1-CSB-PA242639 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
MUTYH Antibody |
1-CSB-PA015245GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MUTYH. Recognizes MUTYH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MUTYH antibody |
70R-51594 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal MUTYH antibody |
MUTYH antibody |
70R-33839 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal MUTYH antibody |
MUTYH Antibody |
AF0379 |
Affbiotech |
200ul |
EUR 304 |
Description: MUTYH antibody detects endogenous levels of total MUTYH. |
MUTYH siRNA |
20-abx903397 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUTYH siRNA |
20-abx925057 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUTYH siRNA |
20-abx925058 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human MUTYH shRNA Plasmid |
20-abx953027 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MUTYH Recombinant Protein (Human) |
RP020413 |
ABM |
100 ug |
Ask for price |
MUTY protein (His tag) |
80R-2761 |
Fitzgerald |
10 ug |
EUR 322 |
Description: Purified recombinant MUTY protein (His tag) |
MUTYH Rabbit pAb |
A1612-100ul |
Abclonal |
100 ul |
EUR 308 |
MUTYH Rabbit pAb |
A1612-200ul |
Abclonal |
200 ul |
EUR 459 |
MUTYH Rabbit pAb |
A1612-20ul |
Abclonal |
20 ul |
EUR 183 |
MUTYH Rabbit pAb |
A1612-50ul |
Abclonal |
50 ul |
EUR 223 |
MUTYH Blocking Peptide |
DF6500-BP |
Affbiotech |
1mg |
EUR 195 |
MUTYH Blocking Peptide |
20-abx062169 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUTYH Blocking Peptide |
AF0379-BP |
Affbiotech |
1mg |
EUR 195 |
MUTYH Conjugated Antibody |
C31101 |
SAB |
100ul |
EUR 397 |
MUTYH Conjugated Antibody |
C38267 |
SAB |
100ul |
EUR 397 |
MUTYH cloning plasmid |
CSB-CL883426HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1608
- Sequence: atgacaccgctcgtctcccgcctgagtcgtctgtgggccatcatgaggaagccacgagcagccgtgggaagtggtcacaggaagcaggcagccagccaggaagggaggcagaagcatgctaagaacaacagtcaggccaagccttctgcctgtgatggcctggccaggcagccgg
- Show more
|
Description: A cloning plasmid for the MUTYH gene. |
MUTYH Rabbit pAb |
A2265-100ul |
Abclonal |
100 ul |
EUR 308 |
MUTYH Rabbit pAb |
A2265-200ul |
Abclonal |
200 ul |
EUR 459 |
MUTYH Rabbit pAb |
A2265-20ul |
Abclonal |
20 ul |
Ask for price |
MUTYH Rabbit pAb |
A2265-50ul |
Abclonal |
50 ul |
Ask for price |
anti- MUTYH antibody |
FNab05445 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: mutY homolog(E. coli)
- Uniprot ID: Q9UIF7
- Gene ID: 4595
- Research Area: Metabolism
|
Description: Antibody raised against MUTYH |
anti- MUTYH antibody |
FNab05446 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: mutY homolog(E. coli)
- Uniprot ID: Q9UIF7
- Gene ID: 4595
- Research Area: Metabolism
|
Description: Antibody raised against MUTYH |
Anti-MUTYH antibody |
STJ24647 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-MUTYH antibody |
STJ24648 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-MUTYH antibody |
STJ140046 |
St John's Laboratory |
150 µg |
EUR 219 |
Description: polyclonal antibody to MUTYH. MUTYH is involved in oxidative DNA damage repair. It nicks DNA replication errors, specifically A/G mismatches. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
MUTYH ORF Vector (Human) (pORF) |
ORF006805 |
ABM |
1.0 ug DNA |
EUR 95 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Recombinant Human MutY Protein for Western blot |
MUTY11-C |
Alpha Diagnostics |
100 ul |
EUR 286 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A1924-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A1924-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G-specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A1924-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human A/G-specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A0952-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A0952-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G specific adenine DNA glycosylase(MUTYH) ELISA kit |
E01A0952-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human A/G specific adenine DNA glycosylase(MUTYH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A/G- specific adenine DNA glycosylase, MUTYH ELISA KIT |
ELI-38607h |
Lifescience Market |
96 Tests |
EUR 824 |
Rat MUTYH shRNA Plasmid |
20-abx987616 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MUTYH shRNA Plasmid |
20-abx977259 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MUTYH Recombinant Protein (Mouse) |
RP152393 |
ABM |
100 ug |
Ask for price |
MUTYH Recombinant Protein (Mouse) |
RP152396 |
ABM |
100 ug |
Ask for price |
MUTYH Recombinant Protein (Rat) |
RP212819 |
ABM |
100 ug |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
MUTYH sgRNA CRISPR Lentivector set (Human) |
K1369401 |
ABM |
3 x 1.0 ug |
EUR 339 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|