Human PCDHb16(Protocadherin Beta 16) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
RD-PCDHb16-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Protocadherin beta 16 (PCDHb16) ELISA Kit |
20-abx152867 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx252906-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Protocadherin beta- 16, PCDHB16 ELISA KIT |
ELI-14608h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
SEE072Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids. |
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
SEE072Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids. |
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
SEE072Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids. |
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
SEE072Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 16 (PCDHb16) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 16 (PCDHb16) in Tissue homogenates and other biological fluids. |
Human Protocadherin Beta 16 (PCDHb16) ELISA Kit |
4-SEE072Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protocadherin Beta 16 elisa. Alternative names of the recognized antigen: PCDHB8a
- PCDH3X
- PCDH-BETA16
- ME1
- Cadherin ME1
- Protocadherin-3x
- PCDHbeta 16
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin Beta 16 (PCDHb16) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Protocadherin Beta 16 (PCDHB16) Antibody |
20-abx210548 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 16 (PCDHB16) Antibody |
abx036812-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 16 (PCDHb16) Antibody |
20-abx128255 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protocadherin Beta 16 (PCDHb16) Antibody |
20-abx174304 |
Abbexa |
|
|
|
Protocadherin Beta 16 (PCDHB16) Antibody |
20-abx338812 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Protocadherin Beta 16 (PCDHb16) |
4-RPE072Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9NRJ7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Protocadherin Beta 16 expressed in: E.coli |
Pig Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx360691-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx359041-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx355520-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx363526-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Protocadherin Beta 16 (PCDHB16) ELISA Kit |
abx364605-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Human Protocadherin Beta 16 (PCDHb16) Protein |
20-abx168211 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Protocadherin Beta 16 (PCDHb16) CLIA Kit |
abx196151-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Protocadherin beta 16 (PCDHb16) CLIA Kit |
20-abx494493 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PCDHb16 (Protocadherin Beta 16) |
ELK3563 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin Beta 16 (PCDH?16). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
- Show more
|
Description: A sandwich ELISA kit for detection of Protocadherin Beta 16 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Protocadherin beta-16 (PCDHB16) |
KTE61296-48T |
Abbkine |
48T |
EUR 332 |
- PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin beta-16 (PCDHB16) |
KTE61296-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin beta-16 (PCDHB16) |
KTE61296-96T |
Abbkine |
96T |
EUR 539 |
- PCDHb16 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene cluste
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-16 (PCDHB16) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Protocadherin Beta 16 (PCDHB16) Antibody (HRP) |
20-abx337354 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 16 (PCDHB16) Antibody (FITC) |
20-abx337355 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 16 (PCDHB16) Antibody (Biotin) |
20-abx337356 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human) |
4-PAE072Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16) |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), APC |
4-PAE072Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with APC. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), Biotinylated |
4-PAE072Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with Biotin. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), Cy3 |
4-PAE072Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with Cy3. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), FITC |
4-PAE072Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with FITC. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), HRP |
4-PAE072Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with HRP. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), PE |
4-PAE072Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with PE. |
Protocadherin Beta 16 (PCDHb16) Polyclonal Antibody (Human), APC-Cy7 |
4-PAE072Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb16 (Val35~Val347)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 16 (PCDHb16). This antibody is labeled with APC-Cy7. |
Human PCDHβ16(Protocadherin Beta 16) ELISA Kit |
EH3516 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q9NRJ7
- Alias: PCDHβ16
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
ELISA kit for Human PCDH?16 (Protocadherin Beta 16) |
E-EL-H0938 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PCDH?16 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?16. Standards or samples are added to the micro ELISA plate wells and combined w
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH?16 (Protocadherin Beta 16) in samples from Serum, Plasma, Cell supernatant |
CLIA kit for Human PCDH?16 (Protocadherin Beta 16) |
E-CL-H0639 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's PCDH?16 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?16 . Standards or samples are added to the micro CLIA plate wells and combined wit
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human PCDH?16 (Protocadherin Beta 16) in samples from Serum, Plasma, Cell supernatant |
Recombinant human Protocadherin-16 |
P1565 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q96JQ0
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Protocadherin-16 |
ELISA kit for Human Protocadherin-16 (DCHS1) |
KTE62136-48T |
Abbkine |
48T |
EUR 332 |
- DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin-16 (DCHS1) |
KTE62136-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin-16 (DCHS1) |
KTE62136-96T |
Abbkine |
96T |
EUR 539 |
- DCHS1 is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family m
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-16 (DCHS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Protocadherin-16 Antibody |
48035-100ul |
SAB |
100ul |
EUR 333 |
Protocadherin-16 Antibody |
48035-50ul |
SAB |
50ul |
EUR 239 |
Protocadherin-16 Antibody |
abx019160-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
99445-16 DCT 16 X 100MM |
99445-16 |
CORNING |
250/pk |
EUR 96 |
Description: Disposable Culture Tubes; DCT's, CGW |
Nucleo 9 Line 16 ELISA kit |
55R-ORG711/16 |
Fitzgerald |
16 Tests |
EUR 399 |
Description: ELISA kit for the detection of Nucleo 9 Line 16 in the research laboratory |
ANA 9 Line Immunoblot 16 ELISA kit |
55R-ORG710/16 |
Fitzgerald |
16 Tests |
EUR 399 |
Description: ELISA kit for the detection of ANA 9 Line Immunoblot 16 in the research laboratory |
IFN beta 1b, Interferon beta 1b, human |
RC217-16 |
Bio Basic |
2ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
Human Protocadherin Beta 15 (PCDHB15) ELISA Kit |
20-abx156781 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protocadherin beta- 15, PCDHB15 ELISA KIT |
ELI-14582h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 4, PCDHB4 ELISA KIT |
ELI-14604h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 5, PCDHB5 ELISA KIT |
ELI-14605h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 9, PCDHB9 ELISA KIT |
ELI-14606h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 14, PCDHB14 ELISA KIT |
ELI-14607h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 10, PCDHB10 ELISA KIT |
ELI-12387h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 3, PCDHB3 ELISA KIT |
ELI-43150h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 1, PCDHB1 ELISA KIT |
ELI-45007h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 7, PCDHB7 ELISA KIT |
ELI-45008h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 2, PCDHB2 ELISA KIT |
ELI-45082h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin Beta 2 (PCDHB2) ELISA Kit |
abx352089-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Protocadherin Beta 12 (PCDHB12) ELISA Kit |
abx382091-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protocadherin Beta 5 (PCDHB5) ELISA Kit |
abx382092-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protocadherin beta- 13, PCDHB13 ELISA KIT |
ELI-35635h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 11, PCDHB11 ELISA KIT |
ELI-35666h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 12, PCDHB12 ELISA KIT |
ELI-35667h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 8, PCDHB8 ELISA KIT |
ELI-37796h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin beta- 6, PCDHB6 ELISA KIT |
ELI-37488h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit |
SEE075Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit |
SEE075Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit |
SEE075Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit |
SEE075Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin Beta 15 (PCDHb15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<1
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin Beta 15 (PCDHb15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin Beta 15 (PCDHb15) ELISA Kit |
4-SEE075Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protocadherin Beta 15 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin Beta 15 (PCDHb15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
PCDHB16 ELISA Kit (Human) (OKCD00415) |
OKCD00415 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Potential calcium-dependent cell-adhesion protein. May be involved in the establishment and maintenance of specific neuronal connections in the brain. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
PCDHb16 ELISA Kit (Human) (OKDD00458) |
OKDD00458 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
RA420A-miR-16 QuantiMir miR-16 --50 assays |
RA420A-miR-16 |
SBI |
50 assays |
EUR 151 |
|
Human Putative protocadherin beta- 18, PCDHB18 ELISA KIT |
ELI-22837h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human PCDHb15 (Protocadherin Beta 15) |
ELK5035 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin Beta 15 (PCDH?15). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pr
- Show more
|
Description: A sandwich ELISA kit for detection of Protocadherin Beta 15 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Protocadherin beta-15 (PCDHB15) |
KTE61297-48T |
Abbkine |
48T |
EUR 332 |
- Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin beta-15 (PCDHB15) |
KTE61297-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protocadherin beta-15 (PCDHB15) |
KTE61297-96T |
Abbkine |
96T |
EUR 539 |
- Protocadherin beta-15 is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell recept
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protocadherin beta-15 (PCDHB15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
0.5-10UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR |
AP-16 |
CORNING |
1/pk |
EUR 625 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Mouse Protocadherin beta- 14, Pcdhb14 ELISA KIT |
ELI-16098m |
Lifescience Market |
96 Tests |
EUR 865 |
Monkey Protocadherin Beta 2 (PCDHB2) ELISA Kit |
abx360057-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Protocadherin Beta 2 (PCDHB2) ELISA Kit |
abx361798-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Protocadherin Beta 2 (PCDHB2) ELISA Kit |
abx362649-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Protocadherin Beta 2 (PCDHB2) ELISA Kit |
abx356573-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
99449 DSSCT 16 X 100MM W/O MARKING SPOT |
99449-16 |
CORNING |
250/pk |
EUR 295 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
Human Protocadherin Beta 15 (PCDHB15) CLIA Kit |
20-abx494494 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PCDH?2 (Protocadherin Beta 2) |
E-EL-H2265 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PCDH?2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH?2. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH?2 (Protocadherin Beta 2) in samples from Serum, Plasma, Cell supernatant |
anti-Protocadherin beta 13 |
YF-PA19964 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Protocadherin beta 13 |
anti-Protocadherin beta 13 |
YF-PA19965 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Protocadherin beta 13 |
anti-Protocadherin beta 12 |
YF-PA26402 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Protocadherin beta 12 |
anti-protocadherin beta 10 |
YF-PA26404 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to protocadherin beta 10 |
anti-Protocadherin beta 3 |
YF-PA26406 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Protocadherin beta 3 |
99448 DSSCT 16 X 125MM FLAT BOTTOM W/O MARKING SPOT |
99448-16 |
CORNING |
250/pk |
EUR 359 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
Human Protocadherin Beta 2 (PCDHb2) Protein |
20-abx068787 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2207.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Protocadherin Beta 15 (PCDHb15) Protein |
20-abx650578 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
T4 (Thyroxine) ELISA test |
16 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of T4 (Thyroxine) |
PCDHB16 Antibody |
35994-100ul |
SAB |
100ul |
EUR 252 |
PCDHB16 Antibody |
1-CSB-PA889094LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCDHB16. Recognizes PCDHB16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
PCDHB16 Antibody |
1-CSB-PA447170 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PCDHB16. Recognizes PCDHB16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PCDHB16 antibody |
70R-8821 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal PCDHB16 antibody |
PCDHB16 siRNA |
20-abx927902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PCDHB16 |
YF-PA20275 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PCDHB16 |
Human Protocadherin 1 ELISA kit |
E01P0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protocadherin 1 ELISA kit |
E01P0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protocadherin 1 ELISA kit |
E01P0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Protocadherin Beta-10 (PCDHB10) Antibody |
abx026395-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-10 (PCDHB10) Antibody |
abx026395-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHB15) Antibody |
abx026558-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHB15) Antibody |
abx026558-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-3 (PCDHB3) Antibody |
abx026623-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-3 (PCDHB3) Antibody |
abx026623-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-14 (PCDHB14) Antibody |
abx026728-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-14 (PCDHB14) Antibody |
abx026728-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 12 (PCDHB12) Antibody |
abx026734-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 12 (PCDHB12) Antibody |
abx026734-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 5 (PCDHB5) Antibody |
abx027291-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 5 (PCDHB5) Antibody |
abx027291-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-1 (PCDHB1) Antibody |
abx028054-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-1 (PCDHB1) Antibody |
abx028054-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 11 (PCDHB11) Antibody |
20-abx211032 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHB15) Antibody |
20-abx211033 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHB15) Antibody |
20-abx211034 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 2 (PCDHb2) Antibody |
20-abx102292 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protocadherin Beta 2 (PCDHb2) Antibody |
20-abx102293 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protocadherin Beta 12 (PCDHB12) Antibody |
20-abx114899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHB15) Antibody |
20-abx114900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta 5 (PCDHB5) Antibody |
20-abx114901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protocadherin Beta-10 (PCDHB10) Antibody |
abx036734-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-4 (PCDHB4) Antibody |
abx037088-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protocadherin Beta-7 (PCDHB7) Antibody |
abx037312-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 11 (PCDHB11) Antibody |
abx038114-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protocadherin Beta 15 (PCDHb15) Antibody |
20-abx130459 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protocadherin Beta 15 (PCDHb15) Antibody |
20-abx174303 |
Abbexa |
|
|
|
Protocadherin Beta 12 (PCDHB12) Antibody |
abx236202-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Protocadherin Beta 5 (PCDHB5) Antibody |
abx236203-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Protocadherin Beta 5 (PCDHB5) Antibody |
abx236204-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Recombinant Protocadherin Beta 2 (PCDHb2) |
4-RPB401Hu01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y5E7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.3kDa
- Isoelectric Point: 5
|
Description: Recombinant Human Protocadherin Beta 2 expressed in: E.coli |
Recombinant Protocadherin Beta 2 (PCDHb2) |
4-RPB401Mu01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q91Y00
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.5kDa
- Isoelectric Point: 5.3
|
Description: Recombinant Mouse Protocadherin Beta 2 expressed in: E.coli |
Recombinant Protocadherin Beta 7 (PCDHb7) |
4-RPE067Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: M0R4V1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 18.5kDa
- Isoelectric Point: 4.2
|
Description: Recombinant Rat Protocadherin Beta 7 expressed in: E.coli |
Recombinant Protocadherin Beta 8 (PCDHb8) |
4-RPE068Mu01 |
Cloud-Clone |
-
EUR 592.80
-
EUR 262.00
-
EUR 1948.00
-
EUR 716.00
-
EUR 1332.00
-
EUR 460.00
-
EUR 4720.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: A8E4K6
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.4kDa
- Isoelectric Point: 4.6
|
Description: Recombinant Mouse Protocadherin Beta 8 expressed in: E.coli |
Recombinant Protocadherin Beta 9 (PCDHb9) |
4-RPE069Hu01 |
Cloud-Clone |
-
EUR 592.80
-
EUR 262.00
-
EUR 1948.00
-
EUR 716.00
-
EUR 1332.00
-
EUR 460.00
-
EUR 4720.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y5E1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.7kDa
- Isoelectric Point: 4.9
|
Description: Recombinant Human Protocadherin Beta 9 expressed in: E.coli |
Recombinant Protocadherin Beta 14 (PCDHb14) |
4-RPE074Mu01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6PB90
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.5kDa
- Isoelectric Point: 5.3
|
Description: Recombinant Mouse Protocadherin Beta 14 expressed in: E.coli |
Recombinant Protocadherin Beta 15 (PCDHb15) |
4-RPE075Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y5E8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Protocadherin Beta 15 expressed in: E.coli |
Anti-Protocadherin beta 12 (1D11) |
YF-MA18928 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Protocadherin beta 12 |
Anti-protocadherin beta 10 (4C4) |
YF-MA18930 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to protocadherin beta 10 |
Anti-Protocadherin beta 3 (4F6) |
YF-MA18932 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Protocadherin beta 3 |
Human PCDHB16 shRNA Plasmid |
20-abx961656 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCDHB16 Recombinant Protein (Human) |
RP022702 |
ABM |
100 ug |
Ask for price |
0.2-2UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR |
AP-16-2 |
CORNING |
1/pk |
EUR 625 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
5-50UL ADJUSTABLE VOLUME 16 CHANNEL AXYPET PIPETTOR |
AP-16-50 |
CORNING |
1/pk |
EUR 625 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Protocadherin Beta 2 (PCDHb2) Polyclonal Antibody (Human) |
4-PAB401Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PCDHb2 (Leu54~Arg291)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Protocadherin Beta 2 (PCDHb2) |
Human Interleukin 16,IL-16 ELISA KIT |
201-12-0097 |
SunredBio |
96 tests |
EUR 440 |
- This Interleukin 16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Interleukin 16, IL-16 ELISA KIT |
CSB-E04605h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 16, IL-16 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Interleukin 16, IL-16 ELISA KIT |
1-CSB-E04605h |
Cusabio |
-
EUR 603.00
-
EUR 4247.00
-
EUR 2260.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 16, IL-16 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Syntaxin 16 (Syntaxin 16) ELISA Kit |
abx259866-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human IL-16(Interleukin 16) ELISA Kit |
EH0178 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: Q14005
- Alias: IL-16(Interleukin 16)/IL16/LCF/NIL16/PRIL16/prIL-16
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Interleukin 16,IL-16 ELISA KIT |
CN-03215H1 |
ChemNorm |
96T |
EUR 434 |
Human Interleukin 16,IL-16 ELISA KIT |
CN-03215H2 |
ChemNorm |
48T |
EUR 284 |
Human Interleukin 16(IL-16)ELISA Kit |
GA-E0136HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Interleukin 16(IL-16)ELISA Kit |
GA-E0136HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Interleukin-16 (IL-16) ELISA Kit |
LF-EK60020 |
Abfrontier |
1×96T |
EUR 790 |
PCDHB16 Rabbit pAb |
A15493-100ul |
Abclonal |
100 ul |
EUR 308 |
PCDHB16 Rabbit pAb |
A15493-200ul |
Abclonal |
200 ul |
EUR 459 |
PCDHB16 Rabbit pAb |
A15493-20ul |
Abclonal |
20 ul |
EUR 183 |
PCDHB16 Rabbit pAb |
A15493-50ul |
Abclonal |
50 ul |
EUR 223 |
PCDHB16 Blocking Peptide |
33R-4089 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCDHB16 antibody, catalog no. 70R-8821 |
PCDHB16 Conjugated Antibody |
C35994 |
SAB |
100ul |
EUR 397 |
PCDHB16 cloning plasmid |
CSB-CL889094HU-10ug |
Cusabio |
10ug |
EUR 762 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2331
- Sequence: atggagattggatggatgcacaatcggagacaaaggcaagtccttgttttctttgttttgctgagcttgtctggggcgggcgccgagttggggtcctattccgtagtggaagaaacggagagaggctcttttgtggcaaatctaggaaaagacctggggttggggttgacagaga
- Show more
|
Description: A cloning plasmid for the PCDHB16 gene. |
Anti-PCDHB16 antibody |
STJ117688 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. |
Anti-PCDHB16 (3H1) |
YF-MA19099 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to PCDHB16 |
Anti-PCDHB16 (3H1) |
YF-MA19100 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PCDHB16 |
Human protocadherin 1,PCDH1 ELISA Kit |
201-12-0235 |
SunredBio |
96 tests |
EUR 440 |
- This protocadherin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
DLR-PCDH15-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
DLR-PCDH15-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protocadherin-10(PCDH10) ELISA kit |
CSB-EL017525HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10 (PCDH10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protocadherin-10(PCDH10) ELISA kit |
1-CSB-EL017525HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10(PCDH10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Protocadherin β 2 ELISA kit |
E01P0065-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protocadherin β 2 ELISA kit |
E01P0065-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protocadherin β 2 ELISA kit |
E01P0065-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
20-abx156777 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protocadherin 15 (PCDH15) ELISA Kit |
20-abx152866 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protocadherin 1 (PCDH1) ELISA Kit |
abx251163-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Protocadherin 15 (PCDH15) ELISA Kit |
abx252905-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human PCDH15(Protocadherin 15) ELISA Kit |
EH3515 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q96QU1
- Alias: PCDH15/CDHR15/DFNB23/PCDH15/USH1F/autosomal recessive 23/cadherin-related family member 15/DKFZp667A1711/protocadherin-15/protocadherin-related 15
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
ELISA kit for Human Protocadherin-1 |
EK3817 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protocadherin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human PCDH1/ Protocadherin-1 ELISA Kit |
E1870Hu |
Sunlong |
1 Kit |
EUR 571 |
Human PCDH1(Protocadherin-1) ELISA Kit |
EH1850 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: Q08174
- Alias: PCDH1/Protocadherin-1/Cadherin-like protein 1/Protocadherin-42/PC42/PCDH42/protocadherin 42/Protocadherin-42/cadherin-like 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Protocadherin-23(DCHS2) ELISA kit |
CSB-EL006545HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23 (DCHS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protocadherin-23(DCHS2) ELISA kit |
1-CSB-EL006545HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23(DCHS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human protocadherin 1,PCDH1 ELISA Kit |
CN-04176H1 |
ChemNorm |
96T |
EUR 455 |
Human protocadherin 1,PCDH1 ELISA Kit |
CN-04176H2 |
ChemNorm |
48T |
EUR 304 |
Human Protocadherin 9 (PCDH9) ELISA Kit |
abx382086-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protocadherin-1 (PCDH1) ELISA Kit |
abx517940-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human protocadherin 1(PCDH1)ELISA Kit |
GA-E0251HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human protocadherin 1(PCDH1)ELISA Kit |
GA-E0251HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Protocadherin 15 (PCDH15) ELISA Kit |
SEE095Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
SEE095Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
SEE095Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
SEE095Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
4-SEE095Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protocadherin 15 elisa. Alternative names of the recognized antigen: USH1F
- DFNB23
- CDHR15
- Deafness, Autosomal Recessive 23
- Cadherin-Related Family Member 15
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 15 (PCDH15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
SEE100Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
SEE100Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
SEE100Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
SEE100Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids. |
Human Protocadherin 20 (PCDH20) ELISA Kit |
4-SEE100Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Protocadherin 20 elisa. Alternative names of the recognized antigen: PCDH13
- Protocadherin-13
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 20 (PCDH20) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Protocadherin 15 (PCDH15) ELISA Kit |
RDR-PCDH15-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Protocadherin 15 (PCDH15) ELISA Kit |
RDR-PCDH15-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Protocadherin 15 (PCDH15) ELISA Kit |
RD-PCDH15-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Protocadherin 15 (PCDH15) ELISA Kit |
RD-PCDH15-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Protocadherin Beta 2 (PCDHb2) Protein |
20-abx068788 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PCDHB16 ORF Vector (Human) (pORF) |
ORF007568 |
ABM |
1.0 ug DNA |
EUR 95 |
ELISA kit for Human IL-16 (Interleukin 16) |
E-EL-H0235 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 377 |
- Gentaur's IL-16 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-16. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human IL-16 (Interleukin 16) in samples from Serum, Plasma, Cell supernatant |