Human BCAN(Brevican) ELISA Kit

Human BCAN(Brevican) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Brevican (BCAN) ELISA Kit
RD-BCAN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Brevican (BCAN) ELISA Kit
RDR-BCAN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Brevican (BCAN) ELISA Kit
RDR-BCAN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human BCAN(Brevican) ELISA Kit
EH2693	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q96GW7 Alias: BCAN/ALPBRE/BEHAB/CSPG7/brevican core protein/Brain-enriched hyaluronan-binding protein/brevican/Chondroitin sulfate proteoglycan 7/chondroitin sulfate proteoglycan BEHAB/chondroitin sulfate p Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Brevican (BCAN) ELISA Kit
SEC177Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.

Human Brevican (BCAN) ELISA Kit
SEC177Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.

Human Brevican (BCAN) ELISA Kit
SEC177Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.

Human Brevican (BCAN) ELISA Kit
SEC177Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.

Human Brevican (BCAN) ELISA Kit
4-SEC177Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Brevican elisa. Alternative names of the recognized antigen: BEHAB CSPG7 Chondroitin Sulfate Proteoglycan 7 Brevican Proteoglycan Brevican core protein Brain-enriched hyaluronan-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Brevican (BCAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Brevican(BCAN)ELISA Kit
QY-E03760	Qayee Biotechnology	96T	EUR 361

Brevican (BCAN) Antibody
20-abx129761	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Brevican (BCAN) Antibody
20-abx175629	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Brevican (BCAN) Antibody
20-abx171478	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Brevican (BCAN)
4-RPC177Mu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61361 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Brevican expressed in: E.coli

ELISA kit for Human BCAN (Brevican)
ELK3158	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Brevican (BCAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Brevican (BCAN). N Show more
Description: A sandwich ELISA kit for detection of Brevican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human BCAN (Brevican)
E-EL-H0603	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's BCAN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant

Human Brevican (BCAN) CLIA Kit
abx196492-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Brevican (BCAN) Protein
20-abx652712	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Brevican core protein, BCAN ELISA KIT
ELI-43626h	Lifescience Market	96 Tests	EUR 824

Human Brevican Core Protein (BCAN) ELISA Kit
20-abx150838	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Brevican Core Protein (BCAN) ELISA Kit
abx252072-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

CLIA kit for Human BCAN (Brevican)
E-CL-H0466	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's BCAN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant

Mouse Brevican (BCAN) Protein
20-abx167300	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pig Brevican Core Protein (BCAN) ELISA Kit
abx361030-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Brevican Core Protein (BCAN) ELISA Kit
abx362862-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Bovine Brevican core protein, BCAN ELISA KIT
ELI-20986b	Lifescience Market	96 Tests	EUR 928

Mouse Brevican core protein, Bcan ELISA KIT
ELI-43627m	Lifescience Market	96 Tests	EUR 865

Chicken Brevican Core Protein (BCAN) ELISA Kit
abx356023-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Brevican Core Protein (BCAN) ELISA Kit
abx359344-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Brevican Core Protein (BCAN) ELISA Kit
abx388711-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Brevican Core Protein (BCAN) ELISA Kit
abx391037-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Brevican Core Protein (BCAN) CLIA Kit
20-abx493521	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Brevican Core Protein (BCAN) Antibody
20-abx124744	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Brevican Core Protein (Bcan) Antibody
20-abx111260	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Brevican Core Protein (BCAN) Antibody
abx036615-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Brevican Core Protein (BCAN) Antibody
abx032663-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Brevican Core Protein (BCAN) Antibody
abx032663-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Brevican Core Protein (Bcan) Antibody
abx445039-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody
abx230954-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Bcan ELISA Kit| Rat Brevican core protein ELISA Kit
EF018390	Lifescience Market	96 Tests	EUR 689

Bcan ELISA Kit| Mouse Brevican core protein ELISA Kit
EF014336	Lifescience Market	96 Tests	EUR 689

BCAN ELISA Kit| Bovine Brevican core protein ELISA Kit
EF011173	Lifescience Market	96 Tests	EUR 689

Guinea pig Brevican Core Protein (BCAN) ELISA Kit
abx357395-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Brevican Core Protein (Bcan) Antibody (ALP)
abx442436-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (APC)
abx442717-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (Biotin)
abx442997-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (FITC)
abx443277-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (HRP)
abx443558-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (PerCP)
abx444120-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (RPE)
abx444401-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (Streptavidin)
abx444682-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat)
4-PAC177Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN)

Brevican Core Protein (Bcan) Antibody (ATTO 390)
abx440188-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 488)
abx440469-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 565)
abx440750-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 594)
abx441031-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 633)
abx441312-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 655)
abx441593-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 680)
abx441874-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican Core Protein (Bcan) Antibody (ATTO 700)
abx442155-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC
4-PAC177Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC177Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Biotin.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC177Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Cy3.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC177Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with FITC.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC177Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with HRP.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), PE
4-PAC177Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with PE.

Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Brevican Core Protein (Bcan) Antibody (PE/ATTO 594)
abx443839-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC177Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: BCAN (Asp23~Arg353) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC-Cy7.

Bcan/ Rat Bcan ELISA Kit
ELI-21537r	Lifescience Market	96 Tests	EUR 886

Human Brevican ELISA kit
E01B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Brevican ELISA kit
E01B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Brevican ELISA kit
E01B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BCAN ELISA Kit
EHB0387	Abclonal	96Tests	EUR 521

BCAN ELISA KIT|Human
EF010421	Lifescience Market	96 Tests	EUR 689

Human Brevican PicoKine ELISA Kit
EK2019	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Brevican in cell culture supernates, serum and plasma (heparin, EDTA).

Goat Brevican ELISA kit
E06B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Brevican ELISA kit
E06B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Brevican ELISA kit
E06B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Brevican ELISA kit
E03B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Brevican ELISA kit
E03B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Brevican ELISA kit
E03B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Brevican ELISA kit
E04B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Brevican ELISA kit
E04B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Brevican ELISA kit
E04B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brevican ELISA kit
E02B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brevican ELISA kit
E02B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Brevican ELISA kit
E02B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Brevican ELISA kit
E07B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Brevican ELISA kit
E07B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Brevican ELISA kit
E07B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Brevican ELISA kit
E09B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Brevican ELISA kit
E09B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Brevican ELISA kit
E09B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Brevican ELISA kit
E08B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Brevican ELISA kit
E08B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Brevican ELISA kit
E08B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BCAN ELISA Kit (Human) (OKCD01645)
OKCD01645	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May play a role in the terminally differentiating and the adult nervous system during postnatal development. Could stabilize interactions between hyaluronan (HA) and brain proteoglycans. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL

BCAN ELISA Kit (Human) (OKBB01388)
OKBB01388	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Brevican core protein is a protein that in humans is encoded by the BCAN gene. This gene is mapped to 1q23.1. Brevican is a member of the lectican protein family. Brevican is localised to the surface of neurons in the brain. In melanocytic cells, BCAN gene expression may be regulated by MITF. This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Goat BCAN ELISA Kit
EGTB0387	Abclonal	96Tests	EUR 521

Canine BCAN ELISA Kit
ECB0387	Abclonal	96Tests	EUR 521

Chicken BCAN ELISA Kit
ECKB0387	Abclonal	96Tests	EUR 521

Bovine BCAN ELISA Kit
EBB0387	Abclonal	96Tests	EUR 521

Anserini BCAN ELISA Kit
EAB0387	Abclonal	96Tests	EUR 521

Rat BCAN ELISA Kit
ERB0387	Abclonal	96Tests	EUR 521

Rabbit BCAN ELISA Kit
ERTB0387	Abclonal	96Tests	EUR 521

Sheep BCAN ELISA Kit
ESB0387	Abclonal	96Tests	EUR 521

Porcine BCAN ELISA Kit
EPB0387	Abclonal	96Tests	EUR 521

Mouse BCAN ELISA Kit
EMB0387	Abclonal	96Tests	EUR 521

Monkey BCAN ELISA Kit
EMKB0387	Abclonal	96Tests	EUR 521

Guinea pig Brevican ELISA kit
E05B0380-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Brevican ELISA kit
E05B0380-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Brevican ELISA kit
E05B0380-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig BCAN ELISA Kit
EGB0387	Abclonal	96Tests	EUR 521

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

anti-Brevican
YF-PA20399	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Brevican

BCAN siRNA
20-abx900602	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BCAN siRNA
20-abx908932	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BCAN siRNA
20-abx908933	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BCAN Antibody
46339-100ul	SAB	100ul	EUR 252

BCAN antibody
70R-15965	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal BCAN antibody

BCAN Antibody
1-CSB-PA002590GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BCAN. Recognizes BCAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human BCAN shRNA Plasmid
20-abx961838	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- Brevican antibody
FNab00954	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 Immunogen: brevican Uniprot ID: Q96GW7 Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against Brevican

Anti-Brevican antibody
PAab00954	Lifescience Market	100 ug	EUR 355

Recombinant human Brevican core protein
P1713	FN Test	100ug	Ask for price
Uniprot ID: Q96GW7 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Brevican core protein

BCAN Conjugated Antibody
C46339	SAB	100ul	EUR 397

BCAN Rabbit pAb
A9368-100ul	Abclonal	100 ul	EUR 308

BCAN Rabbit pAb
A9368-200ul	Abclonal	200 ul	EUR 459

BCAN Rabbit pAb
A9368-20ul	Abclonal	20 ul	EUR 183

BCAN Rabbit pAb
A9368-50ul	Abclonal	50 ul	EUR 223

BCAN cloning plasmid
CSB-CL822220HU1-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2736 Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg Show more
Description: A cloning plasmid for the BCAN gene.

BCAN cloning plasmid
CSB-CL822220HU2-10ug	Cusabio	10ug	EUR 875
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2736 Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg Show more
Description: A cloning plasmid for the BCAN gene.

pCMV-SPORT6-BCAN
PVT12922	Lifescience Market	2 ug	EUR 391

Anti-BCAN antibody
STJ111678	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

BCAN ORF Vector (Human) (pORF)
ORF000959	ABM	1.0 ug DNA	EUR 95

BCAN ORF Vector (Human) (pORF)
ORF000960	ABM	1.0 ug DNA	EUR 95

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Monoclonal antibody for Brevican
SMC-428D	Stressmarq	0.1mg	EUR 353
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated.

Monoclonal antibody for Brevican
SMC-428D-A390	Stressmarq	0.1mg	EUR 400
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 390.

Monoclonal antibody for Brevican
SMC-428D-A488	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 488.

Monoclonal antibody for Brevican
SMC-428D-A565	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 565.

Monoclonal antibody for Brevican
SMC-428D-A594	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 594.

Monoclonal antibody for Brevican
SMC-428D-A633	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 633.

Monoclonal antibody for Brevican
SMC-428D-A655	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 655.

Monoclonal antibody for Brevican
SMC-428D-A680	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 680.

Monoclonal antibody for Brevican
SMC-428D-A700	Stressmarq	0.1mg	EUR 399
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 700.

Monoclonal antibody for Brevican
SMC-428D-ALP	Stressmarq	0.1mg	EUR 393
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Alkaline Phosphatase.

Monoclonal antibody for Brevican
SMC-428D-APC	Stressmarq	0.1mg	EUR 398
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC.

Monoclonal antibody for Brevican
SMC-428D-APCCY7	Stressmarq	0.1mg	EUR 470
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC/Cy7.

Monoclonal antibody for Brevican
SMC-428D-BI	Stressmarq	0.1mg	EUR 395
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Biotin.

Monoclonal antibody for Brevican
SMC-428D-DY350	Stressmarq	0.1mg	EUR 413
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 350.

Monoclonal antibody for Brevican
SMC-428D-DY405	Stressmarq	0.1mg	EUR 402
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 405.

Monoclonal antibody for Brevican
SMC-428D-DY488	Stressmarq	0.1mg	EUR 392
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 488.

Monoclonal antibody for Brevican
SMC-428D-DY594	Stressmarq	0.1mg	EUR 394
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 594.

Monoclonal antibody for Brevican
SMC-428D-DY633	Stressmarq	0.1mg	EUR 389
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 633.

Monoclonal antibody for Brevican
SMC-428D-FITC	Stressmarq	0.1mg	EUR 391
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with FITC.

Monoclonal antibody for Brevican
SMC-428D-HRP	Stressmarq	0.1mg	EUR 387
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with HRP.

Monoclonal antibody for Brevican
SMC-428D-P594	Stressmarq	0.1mg	EUR 406
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PE/ATTO 594.

Monoclonal antibody for Brevican
SMC-428D-PCP	Stressmarq	0.1mg	EUR 398
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PerCP.

Monoclonal antibody for Brevican
SMC-428D-RPE	Stressmarq	0.1mg	EUR 396
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with RPE.

Monoclonal antibody for Brevican
SMC-428D-STR	Stressmarq	0.1mg	EUR 397
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Streptavidin.

Monoclonal antibody for Brevican
SMC-428S	Stressmarq	0.012mg	EUR 65
Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Rat BCAN shRNA Plasmid
20-abx984988	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse BCAN shRNA Plasmid
20-abx969321	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

BCAN sgRNA CRISPR Lentivector set (Human)
K0173001	ABM	3 x 1.0 ug	EUR 339

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

BCAN sgRNA CRISPR Lentivector (Human) (Target 1)
K0173002	ABM	1.0 ug DNA	EUR 154

BCAN sgRNA CRISPR Lentivector (Human) (Target 2)
K0173003	ABM	1.0 ug DNA	EUR 154

BCAN sgRNA CRISPR Lentivector (Human) (Target 3)
K0173004	ABM	1.0 ug DNA	EUR 154

BCAN Protein Vector (Human) (pPB-C-His)
PV003833	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-N-His)
PV003834	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPM-C-HA)
PV003835	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPM-C-His)
PV003836	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-C-His)
PV003837	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-N-His)
PV003838	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPM-C-HA)
PV003839	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPM-C-His)
PV003840	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-His-MBP)
PV326386	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-His-GST)
PV326387	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-His-MBP)
PV326390	ABM	500 ng	EUR 329

BCAN Protein Vector (Human) (pPB-His-GST)
PV326391	ABM	500 ng	EUR 329

Polyclonal BCAN Antibody (C-term)
APR11507G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCAN (C-term). This antibody is tested and proven to work in the following applications:

Bcan ORF Vector (Mouse) (pORF)
ORF039729	ABM	1.0 ug DNA	EUR 506

Bcan ORF Vector (Mouse) (pORF)
ORF039730	ABM	1.0 ug DNA	EUR 506

Bcan ORF Vector (Rat) (pORF)
ORF063981	ABM	1.0 ug DNA	EUR 506

Bcan ORF Vector (Rat) (pORF)
ORF063982	ABM	1.0 ug DNA	EUR 506

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394