Human BCAN(Brevican) ELISA Kit

Human BCAN(Brevican) ELISA Kit

To Order Contact us:

Human Brevican (BCAN) ELISA Kit
RDR-BCAN-Hu-96Tests 96 Tests
EUR 756
Human Brevican (BCAN) ELISA Kit
RD-BCAN-Hu-48Tests 48 Tests
EUR 521
Human Brevican (BCAN) ELISA Kit
RD-BCAN-Hu-96Tests 96 Tests
EUR 723
Human BCAN(Brevican) ELISA Kit
EH2693 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q96GW7
  • Alias: BCAN/ALPBRE/BEHAB/CSPG7/brevican core protein/Brain-enriched hyaluronan-binding protein/brevican/Chondroitin sulfate proteoglycan 7/chondroitin sulfate proteoglycan BEHAB/chondroitin sulfate p
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Brevican(BCAN)ELISA Kit
QY-E03760 96T
EUR 361
Human Brevican (BCAN) ELISA Kit
SEC177Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.
Human Brevican (BCAN) ELISA Kit
SEC177Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.
Human Brevican (BCAN) ELISA Kit
SEC177Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.
Human Brevican (BCAN) ELISA Kit
SEC177Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids.
Human Brevican (BCAN) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Brevican elisa. Alternative names of the recognized antigen: BEHAB
  • CSPG7
  • Chondroitin Sulfate Proteoglycan 7
  • Brevican Proteoglycan
  • Brevican core protein
  • Brain-enriched hyaluronan-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Brevican (BCAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
ELISA kit for Human BCAN (Brevican)
E-EL-H0603 1 plate of 96 wells
EUR 534
  • Gentaur's BCAN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human BCAN (Brevican)
ELK3158 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Brevican (BCAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Brevican (BCAN). N
  • Show more
Description: A sandwich ELISA kit for detection of Brevican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Brevican (BCAN) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Brevican (BCAN) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Brevican (BCAN) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Brevican (BCAN)
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61361
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Brevican expressed in: E.coli
Human Brevican (BCAN) CLIA Kit
abx196492-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Brevican (BCAN) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Brevican Core Protein (BCAN) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Brevican Core Protein (BCAN) ELISA Kit
abx252072-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Brevican core protein, BCAN ELISA KIT
ELI-43626h 96 Tests
EUR 824
CLIA kit for Human BCAN (Brevican)
E-CL-H0466 1 plate of 96 wells
EUR 584
  • Gentaur's BCAN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant
Mouse Brevican (BCAN) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Bovine Brevican core protein, BCAN ELISA KIT
ELI-20986b 96 Tests
EUR 928
Mouse Brevican core protein, Bcan ELISA KIT
ELI-43627m 96 Tests
EUR 865
Monkey Brevican Core Protein (BCAN) ELISA Kit
abx359344-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Brevican Core Protein (BCAN) ELISA Kit
abx361030-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Brevican Core Protein (BCAN) ELISA Kit
abx362862-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Brevican Core Protein (BCAN) ELISA Kit
abx391037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Brevican Core Protein (BCAN) ELISA Kit
abx356023-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Brevican Core Protein (BCAN) ELISA Kit
abx388711-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Brevican Core Protein (BCAN) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Brevican Core Protein (Bcan) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Brevican Core Protein (BCAN) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Brevican Core Protein (BCAN) Antibody
abx036615-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Brevican Core Protein (BCAN) Antibody
abx032663-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Brevican Core Protein (BCAN) Antibody
abx032663-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Brevican Core Protein (Bcan) Antibody
abx445039-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody
abx230954-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Bcan ELISA Kit| Rat Brevican core protein ELISA Kit
EF018390 96 Tests
EUR 689
Bcan ELISA Kit| Mouse Brevican core protein ELISA Kit
EF014336 96 Tests
EUR 689
BCAN ELISA Kit| Bovine Brevican core protein ELISA Kit
EF011173 96 Tests
EUR 689
Guinea pig Brevican Core Protein (BCAN) ELISA Kit
abx357395-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Brevican core protein (BCAN)
KTE101182-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Brevican Core Protein (Bcan) Antibody (ALP)
abx442436-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (APC)
abx442717-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (Biotin)
abx442997-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (FITC)
abx443277-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (HRP)
abx443558-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (PerCP)
abx444120-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (RPE)
abx444401-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (Streptavidin)
abx444682-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN)
Brevican Core Protein (Bcan) Antibody (ATTO 390)
abx440188-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 488)
abx440469-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 565)
abx440750-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 594)
abx441031-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 633)
abx441312-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 655)
abx441593-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 680)
abx441874-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican Core Protein (Bcan) Antibody (ATTO 700)
abx442155-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Biotin.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Cy3.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with FITC.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with HRP.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with PE.
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His)
CA73-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.
Brevican Core Protein (Bcan) Antibody (PE/ATTO 594)
abx443839-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCAN (Asp23~Arg353)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC-Cy7.
Bcan/ Rat Bcan ELISA Kit
ELI-21537r 96 Tests
EUR 886
Human Brevican ELISA kit
E01B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Brevican ELISA kit
E01B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Brevican ELISA kit
E01B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
EHB0387 96Tests
EUR 521
EF010421 96 Tests
EUR 689
Human Brevican PicoKine ELISA Kit
EK2019 96 wells
EUR 425
Description: For quantitative detection of human Brevican in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse Brevican ELISA kit
E03B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Brevican ELISA kit
E03B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Brevican ELISA kit
E03B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brevican ELISA kit
E06B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brevican ELISA kit
E06B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Brevican ELISA kit
E06B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Brevican ELISA kit
E04B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Brevican ELISA kit
E04B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Brevican ELISA kit
E04B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Brevican ELISA kit
E02B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Brevican ELISA kit
E02B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Brevican ELISA kit
E02B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Brevican ELISA kit
E07B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Brevican ELISA kit
E07B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Brevican ELISA kit
E07B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Brevican ELISA kit
E08B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Brevican ELISA kit
E08B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Brevican ELISA kit
E08B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Brevican ELISA kit
E09B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Brevican ELISA kit
E09B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Brevican ELISA kit
E09B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
BCAN ELISA Kit (Human) (OKCD01645)
OKCD01645 96 Wells
EUR 831
Description: Description of target: May play a role in the terminally differentiating and the adult nervous system during postnatal development. Could stabilize interactions between hyaluronan (HA) and brain proteoglycans. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL
BCAN ELISA Kit (Human) (OKBB01388)
OKBB01388 96 Wells
EUR 505
Description: Description of target: Brevican core protein is a protein that in humans is encoded by the BCAN gene. This gene is mapped to 1q23.1. Brevican is a member of the lectican protein family. Brevican is localised to the surface of neurons in the brain. In melanocytic cells, BCAN gene expression may be regulated by MITF. This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
EGTB0387 96Tests
EUR 521
EBB0387 96Tests
EUR 521
ECB0387 96Tests
EUR 521
Chicken BCAN ELISA Kit
ECKB0387 96Tests
EUR 521
Anserini BCAN ELISA Kit
EAB0387 96Tests
EUR 521
EMB0387 96Tests
EUR 521
ERB0387 96Tests
EUR 521
ESB0387 96Tests
EUR 521
ERTB0387 96Tests
EUR 521
EMKB0387 96Tests
EUR 521
Porcine BCAN ELISA Kit
EPB0387 96Tests
EUR 521
Guinea pig Brevican ELISA kit
E05B0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Brevican ELISA kit
E05B0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Brevican ELISA kit
E05B0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea Pig BCAN ELISA Kit
EGB0387 96Tests
EUR 521
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
YF-PA20399 50 ug
EUR 363
Description: Mouse polyclonal to Brevican
BCAN antibody
70R-15965 50 ul
EUR 435
Description: Rabbit polyclonal BCAN antibody
BCAN Antibody
46339-100ul 100ul
EUR 252
BCAN Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BCAN. Recognizes BCAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Human BCAN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- Brevican antibody
FNab00954 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: brevican
  • Uniprot ID: Q96GW7
  • Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against Brevican
Anti-Brevican antibody
PAab00954 100 ug
EUR 355
Recombinant human Brevican core protein
P1713 100ug Ask for price
  • Uniprot ID: Q96GW7
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Brevican core protein
BCAN Conjugated Antibody
C46339 100ul
EUR 397
BCAN cloning plasmid
CSB-CL822220HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2736
  • Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg
  • Show more
Description: A cloning plasmid for the BCAN gene.
BCAN cloning plasmid
CSB-CL822220HU2-10ug 10ug
EUR 875
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2736
  • Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg
  • Show more
Description: A cloning plasmid for the BCAN gene.
BCAN Rabbit pAb
A9368-100ul 100 ul
EUR 308
BCAN Rabbit pAb
A9368-200ul 200 ul
EUR 459
BCAN Rabbit pAb
A9368-20ul 20 ul
EUR 183
BCAN Rabbit pAb
A9368-50ul 50 ul
EUR 223
PVT12922 2 ug
EUR 391
Anti-BCAN antibody
STJ111678 100 µl
EUR 277
Description: This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
BCAN ORF Vector (Human) (pORF)
ORF000959 1.0 ug DNA
EUR 95
BCAN ORF Vector (Human) (pORF)
ORF000960 1.0 ug DNA
EUR 95
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Monoclonal antibody for Brevican
SMC-428D 0.1mg
EUR 353
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated.
Monoclonal antibody for Brevican
SMC-428D-A390 0.1mg
EUR 400
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 390.
Monoclonal antibody for Brevican
SMC-428D-A488 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 488.
Monoclonal antibody for Brevican
SMC-428D-A565 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 565.
Monoclonal antibody for Brevican
SMC-428D-A594 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 594.
Monoclonal antibody for Brevican
SMC-428D-A633 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 633.
Monoclonal antibody for Brevican
SMC-428D-A655 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 655.
Monoclonal antibody for Brevican
SMC-428D-A680 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 680.
Monoclonal antibody for Brevican
SMC-428D-A700 0.1mg
EUR 399
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 700.
Monoclonal antibody for Brevican
SMC-428D-ALP 0.1mg
EUR 393
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Alkaline Phosphatase.
Monoclonal antibody for Brevican
SMC-428D-APC 0.1mg
EUR 398
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC.
Monoclonal antibody for Brevican
SMC-428D-APCCY7 0.1mg
EUR 470
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC/Cy7.
Monoclonal antibody for Brevican
SMC-428D-BI 0.1mg
EUR 395
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Biotin.
Monoclonal antibody for Brevican
SMC-428D-DY350 0.1mg
EUR 413
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 350.
Monoclonal antibody for Brevican
SMC-428D-DY405 0.1mg
EUR 402
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 405.
Monoclonal antibody for Brevican
SMC-428D-DY488 0.1mg
EUR 392
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 488.
Monoclonal antibody for Brevican
SMC-428D-DY594 0.1mg
EUR 394
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 594.
Monoclonal antibody for Brevican
SMC-428D-DY633 0.1mg
EUR 389
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 633.
Monoclonal antibody for Brevican
SMC-428D-FITC 0.1mg
EUR 391
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with FITC.
Monoclonal antibody for Brevican
SMC-428D-HRP 0.1mg
EUR 387
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with HRP.
Monoclonal antibody for Brevican
SMC-428D-P594 0.1mg
EUR 406
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PE/ATTO 594.
Monoclonal antibody for Brevican
SMC-428D-PCP 0.1mg
EUR 398
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PerCP.
Monoclonal antibody for Brevican
SMC-428D-RPE 0.1mg
EUR 396
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with RPE.
Monoclonal antibody for Brevican
SMC-428D-STR 0.1mg
EUR 397
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Streptavidin.
Monoclonal antibody for Brevican
SMC-428S 0.012mg
EUR 65
  • Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
  • Show more
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican . The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Rat BCAN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse BCAN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
BCAN sgRNA CRISPR Lentivector set (Human)
K0173001 3 x 1.0 ug
EUR 339
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
EUR 153
  • Category: Cas9
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
BCAN sgRNA CRISPR Lentivector (Human) (Target 1)
K0173002 1.0 ug DNA
EUR 154
BCAN sgRNA CRISPR Lentivector (Human) (Target 2)
K0173003 1.0 ug DNA
EUR 154
BCAN sgRNA CRISPR Lentivector (Human) (Target 3)
K0173004 1.0 ug DNA
EUR 154
BCAN Protein Vector (Human) (pPB-His-MBP)
PV326386 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-His-GST)
PV326387 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-His-MBP)
PV326390 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-His-GST)
PV326391 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-C-His)
PV003833 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-N-His)
PV003834 500 ng
EUR 329
BCAN Protein Vector (Human) (pPM-C-HA)
PV003835 500 ng
EUR 329
BCAN Protein Vector (Human) (pPM-C-His)
PV003836 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-C-His)
PV003837 500 ng
EUR 329
BCAN Protein Vector (Human) (pPB-N-His)
PV003838 500 ng
EUR 329
BCAN Protein Vector (Human) (pPM-C-HA)
PV003839 500 ng
EUR 329
BCAN Protein Vector (Human) (pPM-C-His)
PV003840 500 ng
EUR 329
Polyclonal BCAN Antibody (C-term)
APR11507G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCAN (C-term). This antibody is tested and proven to work in the following applications:
Bcan ORF Vector (Rat) (pORF)
ORF063981 1.0 ug DNA
EUR 506
Bcan ORF Vector (Rat) (pORF)
ORF063982 1.0 ug DNA
EUR 506
Bcan ORF Vector (Mouse) (pORF)
ORF039729 1.0 ug DNA
EUR 506
Bcan ORF Vector (Mouse) (pORF)
ORF039730 1.0 ug DNA
EUR 506
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428
vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394