Human BCAN(Brevican) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Brevican (BCAN) ELISA Kit |
RDR-BCAN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Brevican (BCAN) ELISA Kit |
RD-BCAN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Brevican (BCAN) ELISA Kit |
RD-BCAN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human BCAN(Brevican) ELISA Kit |
EH2693 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q96GW7
- Alias: BCAN/ALPBRE/BEHAB/CSPG7/brevican core protein/Brain-enriched hyaluronan-binding protein/brevican/Chondroitin sulfate proteoglycan 7/chondroitin sulfate proteoglycan BEHAB/chondroitin sulfate p
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Brevican (BCAN) ELISA Kit |
SEC177Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids. |
Human Brevican (BCAN) ELISA Kit |
SEC177Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids. |
Human Brevican (BCAN) ELISA Kit |
SEC177Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids. |
Human Brevican (BCAN) ELISA Kit |
SEC177Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Brevican (BCAN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Brevican (BCAN) in Tissue homogenates and other biological fluids. |
Human Brevican (BCAN) ELISA Kit |
4-SEC177Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Brevican elisa. Alternative names of the recognized antigen: BEHAB
- CSPG7
- Chondroitin Sulfate Proteoglycan 7
- Brevican Proteoglycan
- Brevican core protein
- Brain-enriched hyaluronan-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Brevican (BCAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human BCAN (Brevican) |
E-EL-H0603 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's BCAN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human BCAN (Brevican) |
ELK3158 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Brevican (BCAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Brevican (BCAN). N
- Show more
|
Description: A sandwich ELISA kit for detection of Brevican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Brevican (BCAN) Antibody |
20-abx175629 |
Abbexa |
|
|
|
Brevican (BCAN) Antibody |
20-abx129761 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Brevican (BCAN) Antibody |
20-abx171478 |
Abbexa |
|
|
|
Recombinant Brevican (BCAN) |
4-RPC177Mu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q61361
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 40.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Brevican expressed in: E.coli |
Human Brevican (BCAN) CLIA Kit |
abx196492-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Brevican (BCAN) Protein |
20-abx652712 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Brevican Core Protein (BCAN) ELISA Kit |
20-abx150838 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Brevican Core Protein (BCAN) ELISA Kit |
abx252072-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Brevican core protein, BCAN ELISA KIT |
ELI-43626h |
Lifescience Market |
96 Tests |
EUR 824 |
CLIA kit for Human BCAN (Brevican) |
E-CL-H0466 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's BCAN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BCAN . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human BCAN (Brevican) in samples from Serum, Plasma, Cell supernatant |
Mouse Brevican (BCAN) Protein |
20-abx167300 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Bovine Brevican core protein, BCAN ELISA KIT |
ELI-20986b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Brevican core protein, Bcan ELISA KIT |
ELI-43627m |
Lifescience Market |
96 Tests |
EUR 865 |
Monkey Brevican Core Protein (BCAN) ELISA Kit |
abx359344-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Brevican Core Protein (BCAN) ELISA Kit |
abx361030-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Brevican Core Protein (BCAN) ELISA Kit |
abx362862-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rat Brevican Core Protein (BCAN) ELISA Kit |
abx391037-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Brevican Core Protein (BCAN) ELISA Kit |
abx356023-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Brevican Core Protein (BCAN) ELISA Kit |
abx388711-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Brevican Core Protein (BCAN) CLIA Kit |
20-abx493521 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Brevican Core Protein (Bcan) Antibody |
20-abx111260 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Brevican Core Protein (BCAN) Antibody |
20-abx124744 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Brevican Core Protein (BCAN) Antibody |
abx036615-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Brevican Core Protein (BCAN) Antibody |
abx032663-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Brevican Core Protein (BCAN) Antibody |
abx032663-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Brevican Core Protein (Bcan) Antibody |
abx445039-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody |
abx230954-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Bcan ELISA Kit| Rat Brevican core protein ELISA Kit |
EF018390 |
Lifescience Market |
96 Tests |
EUR 689 |
Bcan ELISA Kit| Mouse Brevican core protein ELISA Kit |
EF014336 |
Lifescience Market |
96 Tests |
EUR 689 |
BCAN ELISA Kit| Bovine Brevican core protein ELISA Kit |
EF011173 |
Lifescience Market |
96 Tests |
EUR 689 |
Guinea pig Brevican Core Protein (BCAN) ELISA Kit |
abx357395-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat Brevican core protein (BCAN) |
KTE101182-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Brevican core protein (BCAN) |
KTE101182-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Brevican core protein (BCAN) |
KTE101182-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Rat Brevican core protein (BCAN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Brevican Core Protein (Bcan) Antibody (ALP) |
abx442436-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (APC) |
abx442717-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (Biotin) |
abx442997-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (FITC) |
abx443277-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (HRP) |
abx443558-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (PerCP) |
abx444120-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (RPE) |
abx444401-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (Streptavidin) |
abx444682-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat) |
4-PAC177Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN) |
Brevican Core Protein (Bcan) Antibody (ATTO 390) |
abx440188-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 488) |
abx440469-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 565) |
abx440750-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 594) |
abx441031-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 633) |
abx441312-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 655) |
abx441593-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 680) |
abx441874-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican Core Protein (Bcan) Antibody (ATTO 700) |
abx442155-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC |
4-PAC177Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC. |
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAC177Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Biotin. |
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAC177Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with Cy3. |
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAC177Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with FITC. |
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAC177Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with HRP. |
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), PE |
4-PAC177Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with PE. |
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His) |
CA73-10ug |
Novoprotein |
10ug |
EUR 156 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His) |
CA73-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His) |
CA73-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Brevican Core Protein/BCAN/BEHAB (C-6His) |
CA73-50ug |
Novoprotein |
50ug |
EUR 369 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Brevican Core Protein (Bcan) Antibody (PE/ATTO 594) |
abx443839-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
Brevican (BCAN) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAC177Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCAN (Asp23~Arg353)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Brevican (BCAN). This antibody is labeled with APC-Cy7. |
Human Brevican ELISA kit |
E01B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Brevican ELISA kit |
E01B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Brevican ELISA kit |
E01B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BCAN ELISA Kit |
EHB0387 |
Abclonal |
96Tests |
EUR 521 |
Human Brevican PicoKine ELISA Kit |
EK2019 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Brevican in cell culture supernates, serum and plasma (heparin, EDTA). |
Mouse Brevican ELISA kit |
E03B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Brevican ELISA kit |
E03B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Brevican ELISA kit |
E03B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Brevican ELISA kit |
E06B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Brevican ELISA kit |
E06B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Brevican ELISA kit |
E06B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Brevican ELISA kit |
E04B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Brevican ELISA kit |
E04B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Brevican ELISA kit |
E04B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Brevican ELISA kit |
E02B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Brevican ELISA kit |
E02B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Brevican ELISA kit |
E02B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Brevican ELISA kit |
E07B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Brevican ELISA kit |
E07B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Brevican ELISA kit |
E07B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Brevican ELISA kit |
E08B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Brevican ELISA kit |
E08B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Brevican ELISA kit |
E08B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Brevican ELISA kit |
E09B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Brevican ELISA kit |
E09B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Brevican ELISA kit |
E09B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BCAN ELISA Kit (Human) (OKCD01645) |
OKCD01645 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May play a role in the terminally differentiating and the adult nervous system during postnatal development. Could stabilize interactions between hyaluronan (HA) and brain proteoglycans. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.128 ng/mL |
BCAN ELISA Kit (Human) (OKBB01388) |
OKBB01388 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Brevican core protein is a protein that in humans is encoded by the BCAN gene. This gene is mapped to 1q23.1. Brevican is a member of the lectican protein family. Brevican is localised to the surface of neurons in the brain. In melanocytic cells, BCAN gene expression may be regulated by MITF. This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Goat BCAN ELISA Kit |
EGTB0387 |
Abclonal |
96Tests |
EUR 521 |
Bovine BCAN ELISA Kit |
EBB0387 |
Abclonal |
96Tests |
EUR 521 |
Canine BCAN ELISA Kit |
ECB0387 |
Abclonal |
96Tests |
EUR 521 |
Chicken BCAN ELISA Kit |
ECKB0387 |
Abclonal |
96Tests |
EUR 521 |
Anserini BCAN ELISA Kit |
EAB0387 |
Abclonal |
96Tests |
EUR 521 |
Mouse BCAN ELISA Kit |
EMB0387 |
Abclonal |
96Tests |
EUR 521 |
Rat BCAN ELISA Kit |
ERB0387 |
Abclonal |
96Tests |
EUR 521 |
Sheep BCAN ELISA Kit |
ESB0387 |
Abclonal |
96Tests |
EUR 521 |
Rabbit BCAN ELISA Kit |
ERTB0387 |
Abclonal |
96Tests |
EUR 521 |
Monkey BCAN ELISA Kit |
EMKB0387 |
Abclonal |
96Tests |
EUR 521 |
Porcine BCAN ELISA Kit |
EPB0387 |
Abclonal |
96Tests |
EUR 521 |
Guinea pig Brevican ELISA kit |
E05B0380-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Brevican ELISA kit |
E05B0380-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Brevican ELISA kit |
E05B0380-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Brevican in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea Pig BCAN ELISA Kit |
EGB0387 |
Abclonal |
96Tests |
EUR 521 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
anti-Brevican |
YF-PA20399 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Brevican |
BCAN antibody |
70R-15965 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BCAN antibody |
BCAN Antibody |
46339-100ul |
SAB |
100ul |
EUR 252 |
BCAN Antibody |
1-CSB-PA002590GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against BCAN. Recognizes BCAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BCAN siRNA |
20-abx900602 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCAN siRNA |
20-abx908932 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCAN siRNA |
20-abx908933 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human BCAN shRNA Plasmid |
20-abx961838 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
anti- Brevican antibody |
FNab00954 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- Immunogen: brevican
- Uniprot ID: Q96GW7
- Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
|
Description: Antibody raised against Brevican |
Recombinant human Brevican core protein |
P1713 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q96GW7
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Brevican core protein |
BCAN Conjugated Antibody |
C46339 |
SAB |
100ul |
EUR 397 |
BCAN cloning plasmid |
CSB-CL822220HU1-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2736
- Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg
- Show more
|
Description: A cloning plasmid for the BCAN gene. |
BCAN cloning plasmid |
CSB-CL822220HU2-10ug |
Cusabio |
10ug |
EUR 875 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2736
- Sequence: atggcccagctgttcctgcccctgctggcagccctggtcctggcccaggctcctgcagctttagcagatgttctggaaggagacagctcagaggaccgcgcttttcgcgtgcgcatcgcgggcgacgcgccactgcagggcgtgctcggcggcgccctcaccatcccttgccacg
- Show more
|
Description: A cloning plasmid for the BCAN gene. |
BCAN Rabbit pAb |
A9368-100ul |
Abclonal |
100 ul |
EUR 308 |
BCAN Rabbit pAb |
A9368-200ul |
Abclonal |
200 ul |
EUR 459 |
BCAN Rabbit pAb |
A9368-20ul |
Abclonal |
20 ul |
EUR 183 |
BCAN Rabbit pAb |
A9368-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-BCAN antibody |
STJ111678 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
BCAN ORF Vector (Human) (pORF) |
ORF000959 |
ABM |
1.0 ug DNA |
EUR 95 |
BCAN ORF Vector (Human) (pORF) |
ORF000960 |
ABM |
1.0 ug DNA |
EUR 95 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Monoclonal antibody for Brevican |
SMC-428D |
Stressmarq |
0.1mg |
EUR 353 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated. |
Monoclonal antibody for Brevican |
SMC-428D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 390. |
Monoclonal antibody for Brevican |
SMC-428D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 488. |
Monoclonal antibody for Brevican |
SMC-428D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 565. |
Monoclonal antibody for Brevican |
SMC-428D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 594. |
Monoclonal antibody for Brevican |
SMC-428D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 633. |
Monoclonal antibody for Brevican |
SMC-428D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 655. |
Monoclonal antibody for Brevican |
SMC-428D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 680. |
Monoclonal antibody for Brevican |
SMC-428D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with ATTO 700. |
Monoclonal antibody for Brevican |
SMC-428D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for Brevican |
SMC-428D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC. |
Monoclonal antibody for Brevican |
SMC-428D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with APC/Cy7. |
Monoclonal antibody for Brevican |
SMC-428D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Biotin. |
Monoclonal antibody for Brevican |
SMC-428D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 350. |
Monoclonal antibody for Brevican |
SMC-428D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 405. |
Monoclonal antibody for Brevican |
SMC-428D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 488. |
Monoclonal antibody for Brevican |
SMC-428D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 594. |
Monoclonal antibody for Brevican |
SMC-428D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Dylight 633. |
Monoclonal antibody for Brevican |
SMC-428D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with FITC. |
Monoclonal antibody for Brevican |
SMC-428D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with HRP. |
Monoclonal antibody for Brevican |
SMC-428D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PE/ATTO 594. |
Monoclonal antibody for Brevican |
SMC-428D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with PerCP. |
Monoclonal antibody for Brevican |
SMC-428D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with RPE. |
Monoclonal antibody for Brevican |
SMC-428D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is conjugated with Streptavidin. |
Monoclonal antibody for Brevican |
SMC-428S |
Stressmarq |
0.012mg |
EUR 65 |
- Brevican is the most abundant chondroitin sulfate proteoglycan in the extracellular matrix of the adult brain. It is a member of the lectican family of aggregating extracellular matrix proteoglycans that bear chondroitin sulfate (CS) chains. It is hi
- Show more
|
Description: A monoclonal antibody from clone S294A-6 against Human Brevican. The host species for the production of this antibody is Mouse. The antigen used for immunization is Rat Fusion protein amino acids 219-655 of rat Brevican
. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for Brevican is not conjugated. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Rat BCAN shRNA Plasmid |
20-abx984988 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse BCAN shRNA Plasmid |
20-abx969321 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
BCAN sgRNA CRISPR Lentivector set (Human) |
K0173001 |
ABM |
3 x 1.0 ug |
EUR 339 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
BCAN sgRNA CRISPR Lentivector (Human) (Target 1) |
K0173002 |
ABM |
1.0 ug DNA |
EUR 154 |
BCAN sgRNA CRISPR Lentivector (Human) (Target 2) |
K0173003 |
ABM |
1.0 ug DNA |
EUR 154 |
BCAN sgRNA CRISPR Lentivector (Human) (Target 3) |
K0173004 |
ABM |
1.0 ug DNA |
EUR 154 |
BCAN Protein Vector (Human) (pPB-His-MBP) |
PV326386 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-His-GST) |
PV326387 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-His-MBP) |
PV326390 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-His-GST) |
PV326391 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-C-His) |
PV003833 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-N-His) |
PV003834 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPM-C-HA) |
PV003835 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPM-C-His) |
PV003836 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-C-His) |
PV003837 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPB-N-His) |
PV003838 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPM-C-HA) |
PV003839 |
ABM |
500 ng |
EUR 329 |
BCAN Protein Vector (Human) (pPM-C-His) |
PV003840 |
ABM |
500 ng |
EUR 329 |
Polyclonal BCAN Antibody (C-term) |
APR11507G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCAN (C-term). This antibody is tested and proven to work in the following applications: |
Bcan ORF Vector (Rat) (pORF) |
ORF063981 |
ABM |
1.0 ug DNA |
EUR 506 |
Bcan ORF Vector (Rat) (pORF) |
ORF063982 |
ABM |
1.0 ug DNA |
EUR 506 |
Bcan ORF Vector (Mouse) (pORF) |
ORF039729 |
ABM |
1.0 ug DNA |
EUR 506 |
Bcan ORF Vector (Mouse) (pORF) |
ORF039730 |
ABM |
1.0 ug DNA |
EUR 506 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |