Human VRK1(Vaccinia Related Kinase 1) ELISA Kit
To Order Contact us: Lara@lipidx.org
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
RD-VRK1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
20-abx153490 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit |
201-12-2457 |
SunredBio |
96 tests |
EUR 440 |
- This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
SEC600Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids. |
Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit |
4-SEC600Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Vaccinia Related Kinase 1 elisa. Alternative names of the recognized antigen: Serine/threonine-protein kinase VRK1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Vaccinia Related Kinase 1 (VRK1) Antibody |
20-abx102584 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Vaccinia Related Kinase 1 (VRK1) Antibody |
20-abx175051 |
Abbexa |
|
|
|
Recombinant Vaccinia Related Kinase 1 (VRK1) |
4-RPC600Hu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99986
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli |
Human Vaccinia Related Kinase 1 (VRK1) Protein |
20-abx069616 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit |
20-abx493787 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human VRK1 (Vaccinia Related Kinase 1) |
ELK3275 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vaccinia Related Kinase 1 (VRK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
- Show more
|
Description: A sandwich ELISA kit for detection of Vaccinia Related Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human) |
4-PAC600Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1) |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC |
4-PAC600Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated |
4-PAC600Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3 |
4-PAC600Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC |
4-PAC600Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP |
4-PAC600Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE |
4-PAC600Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE. |
Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC600Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: VRK1 (Gly46~Glu292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7. |
Vaccinia Related Kinase 2 (VRK2) Antibody |
20-abx116561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vaccinia Related Kinase 3 (VRK3) Antibody |
20-abx116562 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT |
ELI-17460h |
Lifescience Market |
96 Tests |
EUR 824 |
VRK3 Vaccinia Related Kinase 3 Human Recombinant Protein |
PROTQ8IV63 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: VRK3 Human Recombinant produced in E. coli is a single polypeptide chain containing 497 amino acids (1-474) and having a molecular mass of 55.3 kDa.;VRK3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-48T |
Abbkine |
48T |
EUR 332 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1) |
KTE60047-96T |
Abbkine |
96T |
EUR 539 |
- Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT |
ELI-16975m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT |
ELI-35280b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit |
abx390835-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS |
EF016479 |
Lifescience Market |
96 Tests |
EUR 689 |
VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI |
EF012014 |
Lifescience Market |
96 Tests |
EUR 689 |
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx142305 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx034922-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx037186-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx033380-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
abx033380-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx007048 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody |
20-abx321912 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse Serine/threonine-protein kinase VRK1 (Vrk1) |
1-CSB-YP768902MOb1 |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast |
Mouse Serine/threonine-protein kinase VRK1 (Vrk1) |
1-CSB-EP768902MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 55.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli |
VRK1 ELISA Kit (Human) (OKCD00339) |
OKCD00339 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Serine/threonine kinase involved in Golgi disassembly during the cell cycle: following phosphorylation by PLK3 during mitosis, required to induce Golgi fragmentation. Acts by mediating phosphorylation of downstream target protein. Phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Phosphorylates casein and histone H3. Phosphorylates BANF1: disrupts its ability to bind DNA, reduces its binding to LEM domain-containing proteins and causes its relocalization from the nucleus to the cytoplasm. Phosphorylates ATF2 which activates its transcriptional activity.6 Publications
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein."_x005F_x005F_x000D_Lopez-Borges S., Lazo P.A._x005F_x005F_x000D_Oncogene 19:3656-3664(2000) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, AUTOPHOSPHORYLATION, MUTAGENESIS OF SER-14; THR-102; SER-125; SER-150; SER-158; SER-239; THR-305; THR-312; THR-355 AND THR-390.Ref.5"Characterization of three paralogous members of the Mammalian vaccinia related kinase family."_x005F_x005F_x000D_Nichols R.J., Traktman P._x005F_x005F_x000D_J. Biol. Chem. 279:7934-7946(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION.Ref.6"Human vaccinia-related kinase 1 (VRK1) activates the ATF2 transcriptional activity by novel phosphorylation on Thr-73 and Ser-62 and cooperates with JNK."_x005F_x005F_x000D_Sevilla A., Santos C.R., Vega F.M., Lazo P.A._x005F_x005F_x000D_J. Biol. Chem. 279:27458-27465(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.8"The vaccinia-related kinases phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the nucleus."_x005F_x005F_x000D_Nichols R.J., Wiebe M.S., Traktman P._x005F_x005F_x000D_Mol. Biol. Cell 17:2451-2464(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.9"Proteomics identification of nuclear Ran GTPase as an inhibitor of human VRK1 and VRK2 (vaccinia-related kinase) activities."_x005F_x005F_x000D_Sanz-Garcia M., Lopez-Sanchez I., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Proteomics 7:2199-2214(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH RAN, ENZYME REGULATION.Ref.11"Plk3 interacts with and specifically phosphorylates VRK1 in Ser342, a downstream target in a pathway that induces Golgi fragmentation."_x005F_x005F_x000D_Lopez-Sanchez I., Sanz-Garcia M., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Biol. 29:1189-1201(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION AT SER-342, MUTAGENESIS OF LYS-179 AND SER-342. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL |
VRK1 ELISA Kit (Human) (OKDD00592) |
OKDD00592 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL |
Human Fyn Related Kinase (FRK) ELISA Kit |
abx387420-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Haptoglobin-Related Protein (HPR) AssayMax ELISA Kit |
EH2233-1 |
AssayPro |
96 Well Plate |
EUR 477 |
VRK1 siRNA |
20-abx939552 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VRK1 siRNA |
20-abx939553 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VRK1 Antibody |
43595-100ul |
SAB |
100ul |
EUR 252 |
VRK1 Antibody |
DF9892 |
Affbiotech |
200ul |
EUR 304 |
Description: VRK1 Antibody detects endogenous levels of total VRK1. |
VRK1 Antibody |
1-CSB-PA857466DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
anti-VRK1 |
YF-PA15288 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to VRK1 |
anti-VRK1 |
YF-PA15289 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to VRK1 |
anti-VRK1 |
YF-PA15290 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to VRK1 |
anti-VRK1 |
YF-PA24959 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to VRK1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Fyn Related Kinase (FRK) ELISA Kit |
abx595754-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human VRK1 shRNA Plasmid |
20-abx955093 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ERK(ELK-Related Tyrosine Kinase) ELISA Kit |
EH3010 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: P29323
- Alias: ERK/Cek5/Drt/Hek5/Nuk/Qek2/Sek3/Tyro5/CAPB/DRTEphB2/EC 2.7.10/EC 2.7.10.1/EK5/elk-related tyrosine kinase/EPH receptor B2/eph tyrosine kinase 3/EPH-like kinase 5/ephrin type-B receptor 2/EPHT3
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Nik- related protein kinase, NRK ELISA KIT |
ELI-44856h |
Lifescience Market |
96 Tests |
EUR 824 |
Human NIMA Related Kinase 11 (NEK11) ELISA Kit |
abx381761-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human NIMA Related Kinase 3 (NEK3) ELISA Kit |
abx381762-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human NIMA Related Kinase 9 (NEK9) ELISA Kit |
abx381763-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Nik-related protein kinase (NRK) ELISA Kit |
abx385224-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Vaccinia Virus Antibody |
abx022301-1mg |
Abbexa |
1 mg |
EUR 1017 |
- Shipped within 5-10 working days.
|
Vaccinia Virus Antibody |
abx022303-1mg |
Abbexa |
1 mg |
EUR 1017 |
- Shipped within 5-10 working days.
|
Vaccinia Virus Antibody |
abx022304-1mg |
Abbexa |
1 mg |
EUR 1121 |
- Shipped within 5-10 working days.
|
Vaccinia Virus antibody |
10-1522 |
Fitzgerald |
100 ug |
EUR 325 |
Description: Mouse monoclonal Vaccinia Virus antibody |
Vaccinia Virus antibody |
10-1523 |
Fitzgerald |
100 ug |
EUR 330 |
Description: Mouse monoclonal Vaccinia Virus antibody |
Vaccinia virus antibody |
20C-CR1239RP |
Fitzgerald |
1 ml |
EUR 554 |
Description: Rabbit polyclonal Vaccinia virus antibody |
Vaccinia virus antibody |
20-VR69 |
Fitzgerald |
1 mg |
EUR 116 |
Description: Rabbit polyclonal Vaccinia virus antibody |
Recombivirus Human Anti-Vaccinia virus (VACV) IMV/Envelop protein/H3L/p35 IgG ELISA kit, 96 tests, Quantitative |
AE-311160-1 |
Alpha Diagnostics |
1 kit |
EUR 590 |
VRK1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2620202 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit |
20-abx190165 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
DKK1 Dickkopf-Related Protein 1 Human Recombinant Protein |
PROTO94907-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: DKK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (32-266 a.a) and having a molecular mass of 28.2kDa.;DKK1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Adenylate Kinase 4 (AK 4) AssayMax ELISA Kit |
EA2501-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Nucleoside Diphosphate Kinase D (NDPKD) AssayMax ELISA Kit |
EN2010-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human CellExp? Vaccinia Virus B18R |
8016-10 |
Biovision |
|
EUR 381 |
NIMA Related Kinase 9 (NEK9) ELISA Kit |
abx595418-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse Fyn Related Kinase (FRK) ELISA Kit |
abx389359-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Fyn Related Kinase (FRK) ELISA Kit |
abx391362-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
VRK1 Conjugated Antibody |
C43595 |
SAB |
100ul |
EUR 397 |
VRK1 Polyclonal Antibody |
ES10218-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VRK1 Polyclonal Antibody |
ES10218-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VRK1 Polyclonal Antibody |
ABP60902-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Polyclonal Antibody |
ABP60902-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Polyclonal Antibody |
ABP60902-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein |
VRK1 Rabbit pAb |
A7745-100ul |
Abclonal |
100 ul |
EUR 308 |
VRK1 Rabbit pAb |
A7745-200ul |
Abclonal |
200 ul |
EUR 459 |
VRK1 Rabbit pAb |
A7745-20ul |
Abclonal |
20 ul |
EUR 183 |
VRK1 Rabbit pAb |
A7745-50ul |
Abclonal |
50 ul |
EUR 223 |
VRK1 cloning plasmid |
CSB-CL857466HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1191
- Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt
- Show more
|
Description: A cloning plasmid for the VRK1 gene. |
VRK1 Blocking Peptide |
DF9892-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-VRK1 Antibody |
PB9907 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-VRK1 antibody |
STJ110056 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. |
Anti-VRK1 antibody |
STJ11100814 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. |
Anti-VRK1 antibody |
STJ191376 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VRK1 |
Anti-VRK1 (4F9) |
YF-MA16064 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VRK1 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Human STE20-Related Kinase Adaptor Beta (STRADB) ELISA Kit |
abx383540-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit |
abx387391-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human p21-Activated Kinase 4 (PAK-4) AssayMax ELISA Kit |
EP3201-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
VRK1 ORF Vector (Human) (pORF) |
ORF035819 |
ABM |
1.0 ug DNA |
EUR 405 |
NIMA Related Kinase 1 (NEK1) Antibody |
20-abx334225 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 1 (NEK1) Antibody |
20-abx212767 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GUK1 Human, Guanylate Kinase 1 Human Recombinant Protein, Active |
PROTQ16774-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: GUK1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 217 amino acids (1-197 a.a.)and having a total molecular mass of 23.9 kDa. ;GUK1 is fused to a 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques. |
CDK1 Cyclin-Dependent Kinase 1 Human Recombinant Protein |
PROTP06493-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CDK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 36.2kDa. CDK1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Vaccinia Virus (VACV) Antibody |
abx411671-1ml |
Abbexa |
1 ml |
EUR 606 |
|
Vaccinia Virus (VACV) Antibody |
abx414624-02mg |
Abbexa |
0.2 mg |
EUR 565 |
|
Rabbit anti-Vaccinia antiserum |
01-0003 |
IBT Bioservices |
250uL |
EUR 451 |
Description: - Related to: Other Viruses
- Applications: ELISA, WB
|
Vaccinia Virus TV43 antibody |
10R-V100a |
Fitzgerald |
1 mg |
EUR 732 |
Description: Mouse monoclonal Vaccinia Virus TV43 antibody |
Vaccinia Virus TV46 antibody |
10R-V100b |
Fitzgerald |
1 mg |
EUR 732 |
Description: Mouse monoclonal Vaccinia Virus TV46 antibody |
Vaccinia virus antibody (FITC) |
60-V68 |
Fitzgerald |
1 ml |
EUR 392 |
Description: Rabbit polyclonal Vaccinia virus antibody (FITC) conjugated |
Vaccinia virus antibody (HRP) |
60-V69 |
Fitzgerald |
1 ml |
EUR 408 |
Description: Rabbit polyclonal Vaccinia virus antibody (HRP) conjugated |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Nrk ELISA Kit| Mouse Nik-related protein kinase ELISA Kit |
EF015695 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Nik- related protein kinase, Nrk ELISA KIT |
ELI-13751m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Nik-related protein kinase (NRK) ELISA Kit |
abx390056-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human MAP4K1(MEK Kinase Kinase 1)ELISA Kit |
EH9949 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human MEK Kinase Kinase 1 (MAP4K1) ELISA Kit |
20-abx388409 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit |
E01S0416-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit |
E01S0416-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit |
E01S0416-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Fms-related tyrosine kinase 3 ligand |
EK1088 |
SAB |
96 tests |
EUR 452 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Fms-related tyrosine kinase 3 ligand in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human FLT3LG/ Fms-related tyrosine kinase 3 ligand ELISA Kit |
E0927Hu |
Sunlong |
1 Kit |
EUR 537 |
Human SPS1/STE20- related protein kinase YSK4, YSK4 ELISA KIT |
ELI-28798h |
Lifescience Market |
96 Tests |
EUR 824 |
Human SNF-related serine/threonine-protein kinase (SNRK) ELISA Kit |
abx385418-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
MAPK1 Mitogen-Activated Protein Kinase 1 Human Recombinant Protein |
PROTP28482-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: MAPK1 Recombinant (extracellular signal-regulated kinase) a Mitogen-Activated Protein Kinase, is a highly active form produced by phosphorylation of the purified ERK2/MAPK1 in vitro with MEK1 is a non-glycosylated polypeptide having a molecular mass of 44.6 kDa. _x000D_ MAPK1 is purified by proprietary chromatographic techniques._x000D_ |
Polyclonal VRK1 Antibody (Center) |
APR05905G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications: |
Mouse VRK1 shRNA Plasmid |
20-abx973379 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit |
20-abx190478 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
SUMO1 Small Ubiquitin-Related Modifier 1 Human Recombinant Protein, His Tag |
PROTP63165-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SUMO1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 109 amino acids (1-101) and having a molecular mass of 12.6 kDa.;SUMO1 is fused to a 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques. |
Aurora/IPL1-Related Kinase 1 (ARK-1) Antibody |
abx018156-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Aurora/IPL1-Related Kinase 1 (ARK-1) Antibody |
abx018157-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Vrk1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4353402 |
ABM |
1.0 ug DNA |
EUR 154 |
Vrk1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6439102 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Dickkopf Related Protein 1 ELISA kit |
E01D0161-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dickkopf Related Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dickkopf Related Protein 1 ELISA kit |
E01D0161-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dickkopf Related Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Dickkopf Related Protein 1 ELISA kit |
E01D0161-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Dickkopf Related Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Eledoisin-Related Peptide |
B5233-1 |
ApexBio |
1 mg |
EUR 155 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human Sphingosine kinase 1 ELISA kit |
E01S0447-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sphingosine kinase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Sphingosine kinase 1 ELISA kit |
E01S0447-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sphingosine kinase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Sphingosine kinase 1 ELISA kit |
E01S0447-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sphingosine kinase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
VRK1 sgRNA CRISPR Lentivector set (Human) |
K2620201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-VRK1 (human) (1F6) Monoclonal Antibody |
M03396 |
BosterBio |
100ug |
EUR 397 |
Description: Mouse Monoclonal VRK1 (human) (1F6) Antibody. Validated in WB and tested in Human. |
CSNK2A1 Human, Casein Kinase 2 alpha 1 Human Recombinant Protein, His |
PROTP68400-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CK2A Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain encoding the sequence of 411 amino acids and having a molecular mass of 47.3 kDa.;Casein Kinase 2 alpha subunit is purified by proprietary chromatographic techniques. |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Fms Related Tyrosine Kinase 1 (VEGFR1) Antibody |
20-abx121933 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Fms Related Tyrosine Kinase 1 (VEGFR1) Antibody |
20-abx133009 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Fms Related Tyrosine Kinase 1 (VEGFR1) Antibody |
20-abx012941 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 119.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
20 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Fms Related Tyrosine Kinase 1 (VEGFR1) Antibody |
20-abx004287 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 1 (NEK1) Antibody (HRP) |
20-abx337621 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 1 (NEK1) Antibody (FITC) |
20-abx337622 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIMA Related Kinase 1 (NEK1) Antibody (Biotin) |
20-abx337623 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Fyn Related Kinase (FRK) Protein |
20-abx167021 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Recombinant human Nik-related protein kinase |
P1289 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q7Z2Y5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Nik-related protein kinase |
DAP Kinase-Related Apoptosis-Inducing Protein Kinase 1 (DRAK1) Antibody |
abx033241-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
DAP Kinase-Related Apoptosis-Inducing Protein Kinase 1 (DRAK1) Antibody |
abx033241-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human Mitogen Activated Protein Kinase Kinase Kinase 1 (MAP3K1) ELISA Kit |
abx385164-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Mitogen Activated Protein Kinase Kinase Kinase 1 (MAP3K1)ELISA Kit |
201-12-2493 |
SunredBio |
96 tests |
EUR 440 |
- This Mitogen Activated Protein Kinase Kinase Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Mitogen Activated Protein Kinase Kinase Kinase 1(MAP3K1)ELISA Kit |
QY-E01403 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |