Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit

Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RDR-ASGR2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RD-ASGR2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RD-ASGR2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
20-abx150752	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx252045-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit
EH2669	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P07307 Alias: ASGR2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human ASGR2/ Asialoglycoprotein receptor 2 ELISA Kit
E2881Hu	Sunlong	1 Kit	EUR 605

Human Asialoglycoprotein receptor 2, ASGR2 ELISA KIT
ELI-34137h	Lifescience Market	96 Tests	EUR 824

Human Asialoglycoprotein Receptor 2(ASGR2)ELISA Kit
QY-E01811	Qayee Biotechnology	96T	EUR 361

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
4-SEC067Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Asialoglycoprotein Receptor 2 elisa. Alternative names of the recognized antigen: CLEC4H2 Asialoglyco Protein Receptor 2 C-type lectin domain family 4 member H2 Hepatic lectin H2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Asialoglycoprotein receptor 2 (Asgr2)
1-CSB-EP002208MO1	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 29.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),partial expressed in E.coli

Mouse Asialoglycoprotein receptor 2 (Asgr2)
1-CSB-EP002208MO1b3	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 45.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),Partial expressed in E.coli

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx006333	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx111087	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx126832	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
abx036517-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx128306	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx171333	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx301915	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody
abx230636-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Asialoglycoprotein Receptor 2 (ASGR2)
4-RPC067Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07307 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Asialoglycoprotein Receptor 2 expressed in: E.coli

Mouse Asialoglycoprotein receptor 2, Asgr2 ELISA KIT
ELI-24080m	Lifescience Market	96 Tests	EUR 865

Pig Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx360851-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx390995-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Monkey Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx358743-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx355518-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx363598-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx364247-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx388617-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Asialoglycoprotein Receptor 2 (ASGR2) Protein
20-abx167030	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit
abx196462-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit
20-abx493442	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
E-EL-H0509	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ASGR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
ELK3154	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 2 (ASGR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody (HRP)
20-abx303139	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody (FITC)
20-abx303140	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 2 (ASGR2) Antibody (Biotin)
20-abx303141	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asgr2 ELISA Kit| Rat Asialoglycoprotein receptor 2 ELISA Kit
EF018348	Lifescience Market	96 Tests	EUR 689

Asgr2 ELISA Kit| Mouse Asialoglycoprotein receptor 2 ELISA Kit
EF014242	Lifescience Market	96 Tests	EUR 689

CLIA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
E-CL-H0413	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ASGR2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant

ASGR2 Asialoglycoprotein Receptor 2 Human Recombinant Protein
PROTP07307	BosterBio	Regular: 20ug	EUR 317
Description: ASGR2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 255 amino acids (80-311 a.a) and having a molecular mass of 28.9kDa.;ASGR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine)
4-PAC067Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2)

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC
4-PAC067Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Biotinylated
4-PAC067Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Biotin.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Cy3
4-PAC067Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Cy3.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), FITC
4-PAC067Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with FITC.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), HRP
4-PAC067Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with HRP.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), PE
4-PAC067Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with PE.

Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC-Cy7
4-PAC067Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR2 (Met1~Ala311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC-Cy7.

anti-Asialoglycoprotein Receptor 2
YF-PA10362	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2

anti-Asialoglycoprotein Receptor 2
YF-PA10363	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2

Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Asgr2/ Rat Asgr2 ELISA Kit
ELI-11273r	Lifescience Market	96 Tests	EUR 886

Anti-Asialoglycoprotein Receptor 2 (1D7)
YF-MA10067	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Asialoglycoprotein Receptor 2

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
DLR-ASGR1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
DLR-ASGR1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids.

Human ASGR1/ Asialoglycoprotein receptor 1 ELISA Kit
E0211Hu	Sunlong	1 Kit	EUR 571

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
20-abx150751	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx250636-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Asialoglycoprotein receptor 1
EK2928	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Asialoglycoprotein receptor 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ASGR1(Asialoglycoprotein receptor 1) ELISA Kit
EH1365	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P07306 Alias: ASGR1/ASGPR1/HL-1/CLEC4H1/MHL1/RHL1/ASGPR/ASGP-R 1/asialoglycoprotein receptor 1/C-type lectin domain family 4 member H1/Hepatic lectin H1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Asialoglycoprotein receptor 1, ASGR1 ELISA KIT
ELI-03948h	Lifescience Market	96 Tests	EUR 824

Human Asialoglycoprotein Receptor 1(ASGR1)ELISA Kit
QY-E01812	Qayee Biotechnology	96T	EUR 361

Human Asialoglycoprotein Receptor 1 ELISA Kit (ASGR1)
RK00949	Abclonal	96 Tests	EUR 521

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RDR-ASGR1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RDR-ASGR1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
4-SEB189Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Asialoglycoprotein Receptor 1 elisa. Alternative names of the recognized antigen: CLEC4H1 HL-1 ASGPR 1 Asialoglyco protein Receptor C-type lectin domain family 4 member H1 Hepatic lectin H1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RD-ASGR1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RD-ASGR1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ASGR2 ELISA KIT|Human
EF006617	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-H0510	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
ELK1676	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 1 (ASGR1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Asialoglycoprotein receptor 1 (ASGR1)
1-CSB-RP174694h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 29.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Asialoglycoprotein receptor 1(ASGR1),partial expressed in E.coli

Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx255197-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Asialoglycoprotein receptor 1, Asgr1 ELISA KIT
ELI-03946m	Lifescience Market	96 Tests	EUR 865

Rat Asialoglycoprotein receptor 1, Asgr1 ELISA KIT
ELI-03947r	Lifescience Market	96 Tests	EUR 886

Pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx360769-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx353506-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Chicken Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx357136-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx359056-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx363789-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx515715-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx515716-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse ASGR1(Asialoglycoprotein Receptor 1) ELISA Kit
EM0855	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: P34927 Alias: ASGR1/ASGPR1/CLEC4H1/MHL1/RHL1/ASGPR/ASGPR 1/ASGP-R 1/asialoglycoprotein receptor 1/CLEC4H1ASGPR1/C-type lectin domain family 4 member H1/Hepatic lectin H1/HL-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
abx196461-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
20-abx492476	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ASGR2 ELISA Kit (Human) (OKCD07973)
OKCD07973	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 27.1pg/mL

ASGR2 ELISA Kit (Human) (OKDD00135)
OKDD00135	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.049 ng/mL

ASGR2 ELISA Kit (Human) (OKEH08773)
OKEH08773	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071ng/mL

ASGR1 ELISA Kit| Mouse Asialoglycoprotein Receptor 1 ELISA Kit
EF013453	Lifescience Market	96 Tests	EUR 689

ELISA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-M0159	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-R0075	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant

Guinea pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx357736-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Asialoglycoprotein Receptor 1 (ASGR1) Protein
20-abx166846	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
E-CL-H0414	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant

Mouse Asialoglycoprotein receptor 1 (Asgr1)
1-CSB-EP002207MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 52.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in E.coli

Mouse Asialoglycoprotein receptor 1 (Asgr1)
1-CSB-YP002207MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 27.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in Yeast

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx006394	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx111086	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx036739-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx128768	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx129663	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx109556	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx171332	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx028618-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx028618-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx339945	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx230635-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Asialoglycoprotein Receptor 1 (ASGR1)
4-RPB189Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07306 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.2kDa Isoelectric Point: 5.8
Description: Recombinant Human Asialoglycoprotein Receptor 1 expressed in: E.coli

Recombinant Asialoglycoprotein Receptor 1 (ASGR1)
4-RPB189Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P34927 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.1kDa Isoelectric Point: 6.1
Description: Recombinant Mouse Asialoglycoprotein Receptor 1 expressed in: E.coli

Mouse Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
abx196732-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ASGR2 ELISA Kit (Mouse) (OKCA01630)
OKCA01630	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Mediates the endocytosis of plasma glycoproteins to which the terminal sialic acid residue on their complex carbohydrate moieties has been removed. The receptor recognizes terminal galactose and N-acetylgalactosamine units. After ligand binding to the receptor, the resulting complex is internalized and transported to a sorting organelle, where receptor and ligand are disassociated. The receptor then returns to the cell membrane surface. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL

Human ASGR2 Antibody
33449-05111	AssayPro	150 ug	EUR 261

Asialoglycoprotein Receptor 1 (ASGR1) Antibody (Biotin)
20-abx105163	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody (FITC)
20-abx106580	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody (HRP)
20-abx107997	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Asialoglycoprotein Receptor 1 (ASGR1) Antibody Pair
abx117588-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Mouse Asialoglycoprotein Receptor 1 (ASGR1) Protein
20-abx168418	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1)
E-CL-M0119	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant

Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig)
4-PAB189Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1)

ASGR2 antibody
70R-1145	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2

ASGR2 antibody
70R-2075	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2

ASGR2 antibody
70R-15866	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ASGR2 antibody

ASGR2 Antibody
39942-100ul	SAB	100ul	EUR 390

ASGR2 Antibody
1-CSB-PA002208GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ASGR2 Antibody
1-CSB-PA002208LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ASGR2 Protein
20-abx260966	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

ASGR2 siRNA
20-abx900475	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASGR2 siRNA
20-abx908332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASGR2 siRNA
20-abx908333	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ASGR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0134103	ABM	1.0 ug DNA	EUR 154

Human ASGR2 shRNA Plasmid
20-abx950312	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ASGR2 Recombinant Protein (Human)
RP002062	ABM	100 ug	Ask for price

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse)
4-PAB189Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Thr80~Asp281) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1)

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), APC
4-PAB189Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with APC.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAB189Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Biotin.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Cy3
4-PAB189Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Cy3.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), FITC
4-PAB189Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with FITC.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), HRP
4-PAB189Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with HRP.

Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), PE
4-PAB189Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ASGR1 (Phe77~Pro289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with PE.

Anti-VEGF Receptor 2/KDR Antibody
A00901-2	BosterBio	100ug/vial	EUR 334

Anti-Adiponectin Receptor 2 (mouse) Antibody
A02218-2	BosterBio	200ug	EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9
PROTQ99969-2	BosterBio	Regular: 5ug	EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein
PROTP20333-2	BosterBio	Regular: 20ug	EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

ASGR2 Polyclonal Antibody
30711-100ul	SAB	100ul	EUR 252

ASGR2 Polyclonal Antibody
30711-50ul	SAB	50ul	EUR 187

ASGR2 Polyclonal Antibody
28410-100ul	SAB	100ul	EUR 252

ASGR2 Polyclonal Antibody
28410-50ul	SAB	50ul	EUR 187

ASGR2 Rabbit pAb
A13949-100ul	Abclonal	100 ul	EUR 308

ASGR2 Rabbit pAb
A13949-200ul	Abclonal	200 ul	EUR 459

ASGR2 Rabbit pAb
A13949-20ul	Abclonal	20 ul	EUR 183

ASGR2 Rabbit pAb
A13949-50ul	Abclonal	50 ul	EUR 223

ASGR2 Rabbit pAb
A11830-100ul	Abclonal	100 ul	EUR 308

ASGR2 Rabbit pAb
A11830-200ul	Abclonal	200 ul	EUR 459

ASGR2 Rabbit pAb
A11830-20ul	Abclonal	20 ul	Ask for price

ASGR2 Rabbit pAb
A11830-50ul	Abclonal	50 ul	Ask for price

ASGR2 Blocking Peptide
33R-5548	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-2075

ASGR2 Blocking Peptide
33R-8876	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-1145

ASGR2 cloning plasmid
CSB-CL002208HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 864 Sequence: atggccaaggactttcaagatatccagcagctgagctcggaggaaaatgaccatcctttccatcaagggccacctcctgcccagcccctggcacagcgtctctgctccatggtctgcttcagtctgcttgccctgagcttcaacatcctgctgctggtggtcatctgtgtgactgg Show more
Description: A cloning plasmid for the ASGR2 gene.

ASGR2 Polyclonal Antibody
A62110	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ASGR2 Rabbit pAb
A6281-100ul	Abclonal	100 ul	EUR 308

ASGR2 Rabbit pAb
A6281-200ul	Abclonal	200 ul	EUR 459

ASGR2 Rabbit pAb
A6281-20ul	Abclonal	20 ul	EUR 183

ASGR2 Rabbit pAb
A6281-50ul	Abclonal	50 ul	EUR 223

anti- ASGR2 antibody
FNab00636	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:1000 IP: 1:200-1:1000 IHC: 1:50-1:500 Immunogen: asialoglycoprotein receptor 2 Uniprot ID: P07307 Gene ID: 433 Research Area: Immunology, Signal Transduction
Description: Antibody raised against ASGR2

Anti-ASGR2 antibody
PAab00636	Lifescience Market	100 ug	EUR 355

pENTR223-ASGR2 vector
PVT11940	Lifescience Market	2 ug	EUR 308

Anti-ASGR2 antibody
STJ28203	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR2 antibody
STJ113409	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR2 antibody
STJ115884	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.