Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit

Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RDR-ASGR2-Hu-96Tests 96 Tests
EUR 756
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RD-ASGR2-Hu-48Tests 48 Tests
EUR 521
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
RD-ASGR2-Hu-96Tests 96 Tests
EUR 723
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
20-abx150752
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx252045-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human ASGR2(Asialoglycoprotein Receptor 2) ELISA Kit
EH2669 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P07307
  • Alias: ASGR2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human ASGR2/ Asialoglycoprotein receptor 2 ELISA Kit
E2881Hu 1 Kit
EUR 605
Human Asialoglycoprotein receptor 2, ASGR2 ELISA KIT
ELI-34137h 96 Tests
EUR 824
Human Asialoglycoprotein Receptor 2(ASGR2)ELISA Kit
QY-E01811 96T
EUR 361
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
SEC067Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 2 (ASGR2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in serum, plasma, tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
4-SEC067Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Asialoglycoprotein Receptor 2 elisa. Alternative names of the recognized antigen: CLEC4H2
  • Asialoglyco Protein Receptor 2
  • C-type lectin domain family 4 member H2
  • Hepatic lectin H2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Asialoglycoprotein receptor 2 (Asgr2)
1-CSB-EP002208MO1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),partial expressed in E.coli
Mouse Asialoglycoprotein receptor 2 (Asgr2)
1-CSB-EP002208MO1b3
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 2 (Asgr2),Partial expressed in E.coli
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx006333
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx111087
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx126832
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
abx036517-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx128306
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx171333
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
20-abx301915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody
abx230636-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Asialoglycoprotein Receptor 2 (ASGR2)
4-RPC067Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07307
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Asialoglycoprotein Receptor 2 expressed in: E.coli
Mouse Asialoglycoprotein receptor 2, Asgr2 ELISA KIT
ELI-24080m 96 Tests
EUR 865
Pig Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx360851-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx390995-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Monkey Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx358743-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx355518-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx363598-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx364247-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Mouse Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit
abx388617-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Asialoglycoprotein Receptor 2 (ASGR2) Protein
20-abx167030
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit
abx196462-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Asialoglycoprotein Receptor 2 (ASGR2) CLIA Kit
20-abx493442
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
E-EL-H0509 1 plate of 96 wells
EUR 534
  • Gentaur's ASGR2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
ELK3154 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 2 (ASGR2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (HRP)
20-abx303139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (FITC)
20-abx303140
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 2 (ASGR2) Antibody (Biotin)
20-abx303141
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asgr2 ELISA Kit| Rat Asialoglycoprotein receptor 2 ELISA Kit
EF018348 96 Tests
EUR 689
Asgr2 ELISA Kit| Mouse Asialoglycoprotein receptor 2 ELISA Kit
EF014242 96 Tests
EUR 689
CLIA kit for Human ASGR2 (Asialoglycoprotein Receptor 2)
E-CL-H0413 1 plate of 96 wells
EUR 584
  • Gentaur's ASGR2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR2 (Asialoglycoprotein Receptor 2) in samples from Serum, Plasma, Cell supernatant
ASGR2 Asialoglycoprotein Receptor 2 Human Recombinant Protein
PROTP07307 Regular: 20ug
EUR 317
Description: ASGR2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 255 amino acids (80-311 a.a) and having a molecular mass of 28.9kDa.;ASGR2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine)
4-PAC067Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2)
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC
4-PAC067Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Biotinylated
4-PAC067Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Biotin.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), Cy3
4-PAC067Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with Cy3.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), FITC
4-PAC067Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with FITC.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), HRP
4-PAC067Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with HRP.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), PE
4-PAC067Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with PE.
Asialoglycoprotein Receptor 2 (ASGR2) Polyclonal Antibody (Human, Bovine), APC-Cy7
4-PAC067Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR2 (Met1~Ala311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Asialoglycoprotein Receptor 2 (ASGR2). This antibody is labeled with APC-Cy7.
anti-Asialoglycoprotein Receptor 2
YF-PA10362 50 ug
EUR 363
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2
anti-Asialoglycoprotein Receptor 2
YF-PA10363 50 ug
EUR 363
Description: Mouse polyclonal to Asialoglycoprotein Receptor 2
Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Asialoglycoprotein Receptor 1 ELISA kit
E01A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Asgr2/ Rat Asgr2 ELISA Kit
ELI-11273r 96 Tests
EUR 886
Anti-Asialoglycoprotein Receptor 2 (1D7)
YF-MA10067 100 ug
EUR 363
Description: Mouse monoclonal to Asialoglycoprotein Receptor 2
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
DLR-ASGR1-Hu-48T 48T
EUR 498
  • Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
DLR-ASGR1-Hu-96T 96T
EUR 647
  • Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids.
Human ASGR1/ Asialoglycoprotein receptor 1 ELISA Kit
E0211Hu 1 Kit
EUR 571
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
20-abx150751
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx250636-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Human Asialoglycoprotein receptor 1
EK2928 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Asialoglycoprotein receptor 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ASGR1(Asialoglycoprotein receptor 1) ELISA Kit
EH1365 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P07306
  • Alias: ASGR1/ASGPR1/HL-1/CLEC4H1/MHL1/RHL1/ASGPR/ASGP-R 1/asialoglycoprotein receptor 1/C-type lectin domain family 4 member H1/Hepatic lectin H1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Asialoglycoprotein receptor 1, ASGR1 ELISA KIT
ELI-03948h 96 Tests
EUR 824
Human Asialoglycoprotein Receptor 1(ASGR1)ELISA Kit
QY-E01812 96T
EUR 361
Human Asialoglycoprotein Receptor 1 ELISA Kit (ASGR1)
RK00949 96 Tests
EUR 521
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RDR-ASGR1-Hu-48Tests 48 Tests
EUR 522
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RDR-ASGR1-Hu-96Tests 96 Tests
EUR 724
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
SEB189Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Asialoglycoprotein Receptor 1 (ASGR1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in tissue homogenates and other biological fluids.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
4-SEB189Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Asialoglycoprotein Receptor 1 elisa. Alternative names of the recognized antigen: CLEC4H1
  • HL-1
  • ASGPR 1
  • Asialoglyco protein Receptor
  • C-type lectin domain family 4 member H1
  • Hepatic lectin H1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RD-ASGR1-Hu-48Tests 48 Tests
EUR 500
Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
RD-ASGR1-Hu-96Tests 96 Tests
EUR 692
Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Asialoglycoprotein Receptor 1 ELISA kit
E03A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Asialoglycoprotein Receptor 1 ELISA kit
E04A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Asialoglycoprotein Receptor 1 ELISA kit
E02A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Asialoglycoprotein Receptor 1 ELISA kit
E06A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asialoglycoprotein Receptor 1 ELISA kit
E09A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Asialoglycoprotein Receptor 1 ELISA kit
E08A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Asialoglycoprotein Receptor 1 ELISA kit
E07A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ASGR2 ELISA KIT|Human
EF006617 96 Tests
EUR 689
ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-H0510 1 plate of 96 wells
EUR 534
  • Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
ELK1676 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Asialoglycoprotein Receptor 1 (ASGR1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Asialoglycoprotein Receptor 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Asialoglycoprotein receptor 1 (ASGR1)
1-CSB-RP174694h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Asialoglycoprotein receptor 1(ASGR1),partial expressed in E.coli
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Asialoglycoprotein Receptor 1 ELISA kit
E05A0607-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Asialoglycoprotein Receptor 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx255197-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Asialoglycoprotein receptor 1, Asgr1 ELISA KIT
ELI-03946m 96 Tests
EUR 865
Rat Asialoglycoprotein receptor 1, Asgr1 ELISA KIT
ELI-03947r 96 Tests
EUR 886
Pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx360769-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx353506-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Chicken Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx357136-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx359056-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx363789-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx515715-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Rat Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx515716-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Mouse ASGR1(Asialoglycoprotein Receptor 1) ELISA Kit
EM0855 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P34927
  • Alias: ASGR1/ASGPR1/CLEC4H1/MHL1/RHL1/ASGPR/ASGPR 1/ASGP-R 1/asialoglycoprotein receptor 1/CLEC4H1ASGPR1/C-type lectin domain family 4 member H1/Hepatic lectin H1/HL-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml
Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
abx196461-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
20-abx492476
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
ASGR2 ELISA Kit (Human) (OKCD07973)
OKCD07973 96 Wells
EUR 975
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 27.1pg/mL
ASGR2 ELISA Kit (Human) (OKDD00135)
OKDD00135 96 Wells
EUR 975
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.049 ng/mL
ASGR2 ELISA Kit (Human) (OKEH08773)
OKEH08773 96 Wells
EUR 896
Description: Description of target: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071ng/mL
ASGR1 ELISA Kit| Mouse Asialoglycoprotein Receptor 1 ELISA Kit
EF013453 96 Tests
EUR 689
ELISA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-M0159 1 plate of 96 wells
EUR 534
  • Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat ASGR1 (Asialoglycoprotein Receptor 1)
E-EL-R0075 1 plate of 96 wells
EUR 534
  • Gentaur's ASGR1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ASGR1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant
Guinea pig Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit
abx357736-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Asialoglycoprotein Receptor 1 (ASGR1) Protein
20-abx166846
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CLIA kit for Human ASGR1 (Asialoglycoprotein Receptor 1)
E-CL-H0414 1 plate of 96 wells
EUR 584
  • Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant
Mouse Asialoglycoprotein receptor 1 (Asgr1)
1-CSB-EP002207MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in E.coli
Mouse Asialoglycoprotein receptor 1 (Asgr1)
1-CSB-YP002207MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Asialoglycoprotein receptor 1(Asgr1),partial expressed in Yeast
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx006394
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx111086
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx036739-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx128768
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx129663
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx109556
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx171332
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx028618-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx028618-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
20-abx339945
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody
abx230635-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Asialoglycoprotein Receptor 1 (ASGR1)
4-RPB189Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07306
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.2kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Asialoglycoprotein Receptor 1 expressed in: E.coli
Recombinant Asialoglycoprotein Receptor 1 (ASGR1)
4-RPB189Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P34927
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.1kDa
  • Isoelectric Point: 6.1
Description: Recombinant Mouse Asialoglycoprotein Receptor 1 expressed in: E.coli
Mouse Asialoglycoprotein Receptor 1 (ASGR1) CLIA Kit
abx196732-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
ASGR2 ELISA Kit (Mouse) (OKCA01630)
OKCA01630 96 Wells
EUR 846
Description: Description of target: Mediates the endocytosis of plasma glycoproteins to which the terminal sialic acid residue on their complex carbohydrate moieties has been removed. The receptor recognizes terminal galactose and N-acetylgalactosamine units. After ligand binding to the receptor, the resulting complex is internalized and transported to a sorting organelle, where receptor and ligand are disassociated. The receptor then returns to the cell membrane surface. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.8 pg/mL
Human ASGR2 Antibody
33449-05111 150 ug
EUR 261
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (Biotin)
20-abx105163
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (FITC)
20-abx106580
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody (HRP)
20-abx107997
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Asialoglycoprotein Receptor 1 (ASGR1) Antibody Pair
abx117588-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.
Mouse Asialoglycoprotein Receptor 1 (ASGR1) Protein
20-abx168418
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CLIA kit for Mouse ASGR1 (Asialoglycoprotein Receptor 1)
E-CL-M0119 1 plate of 96 wells
EUR 584
  • Gentaur's ASGR1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ASGR1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ASGR1 (Asialoglycoprotein Receptor 1) in samples from Serum, Plasma, Cell supernatant
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.
Recombinant Human Asialoglycoprotein Receptor 1/ASGPR1 (C-6His)
C428-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig)
4-PAB189Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1)
ASGR2 antibody
70R-1145 100 ug
EUR 377
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2
ASGR2 antibody
70R-2075 50 ug
EUR 467
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2
ASGR2 antibody
70R-15866 50 ul
EUR 435
Description: Rabbit polyclonal ASGR2 antibody
ASGR2 Antibody
39942-100ul 100ul
EUR 390
ASGR2 Antibody
1-CSB-PA002208GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ASGR2 Antibody
1-CSB-PA002208LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
ASGR2 Protein
20-abx260966
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
ASGR2 siRNA
20-abx900475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ASGR2 siRNA
20-abx908332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ASGR2 siRNA
20-abx908333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
ASGR2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0134103 1.0 ug DNA
EUR 154
Human ASGR2 shRNA Plasmid
20-abx950312
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ASGR2 Recombinant Protein (Human)
RP002062 100 ug Ask for price
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Mouse)
4-PAB189Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Thr80~Asp281)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Asialoglycoprotein Receptor 1 (ASGR1)
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), APC
4-PAB189Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with APC.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAB189Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Biotin.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), Cy3
4-PAB189Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with Cy3.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), FITC
4-PAB189Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with FITC.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), HRP
4-PAB189Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with HRP.
Asialoglycoprotein Receptor 1 (ASGR1) Polyclonal Antibody (Human, Pig), PE
4-PAB189Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ASGR1 (Phe77~Pro289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Asialoglycoprotein Receptor 1 (ASGR1). This antibody is labeled with PE.
Anti-VEGF Receptor 2/KDR Antibody
A00901-2 100ug/vial
EUR 334
Anti-Adiponectin Receptor 2 (mouse) Antibody
A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.
RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9
PROTQ99969-2 Regular: 5ug
EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein
PROTP20333-2 Regular: 20ug
EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.
ASGR2 Polyclonal Antibody
30711-100ul 100ul
EUR 252
ASGR2 Polyclonal Antibody
30711-50ul 50ul
EUR 187
ASGR2 Polyclonal Antibody
28410-100ul 100ul
EUR 252
ASGR2 Polyclonal Antibody
28410-50ul 50ul
EUR 187
ASGR2 Rabbit pAb
A13949-100ul 100 ul
EUR 308
ASGR2 Rabbit pAb
A13949-200ul 200 ul
EUR 459
ASGR2 Rabbit pAb
A13949-20ul 20 ul
EUR 183
ASGR2 Rabbit pAb
A13949-50ul 50 ul
EUR 223
ASGR2 Rabbit pAb
A11830-100ul 100 ul
EUR 308
ASGR2 Rabbit pAb
A11830-200ul 200 ul
EUR 459
ASGR2 Rabbit pAb
A11830-20ul 20 ul Ask for price
ASGR2 Rabbit pAb
A11830-50ul 50 ul Ask for price
ASGR2 Blocking Peptide
33R-5548 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-2075
ASGR2 Blocking Peptide
33R-8876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-1145
ASGR2 cloning plasmid
CSB-CL002208HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 864
  • Sequence: atggccaaggactttcaagatatccagcagctgagctcggaggaaaatgaccatcctttccatcaagggccacctcctgcccagcccctggcacagcgtctctgctccatggtctgcttcagtctgcttgccctgagcttcaacatcctgctgctggtggtcatctgtgtgactgg
  • Show more
Description: A cloning plasmid for the ASGR2 gene.
ASGR2 Polyclonal Antibody
A62110 100 µg
EUR 570.55
Description: Ask the seller for details
ASGR2 Rabbit pAb
A6281-100ul 100 ul
EUR 308
ASGR2 Rabbit pAb
A6281-200ul 200 ul
EUR 459
ASGR2 Rabbit pAb
A6281-20ul 20 ul
EUR 183
ASGR2 Rabbit pAb
A6281-50ul 50 ul
EUR 223
anti- ASGR2 antibody
FNab00636 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: asialoglycoprotein receptor 2
  • Uniprot ID: P07307
  • Gene ID: 433
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against ASGR2
Anti-ASGR2 antibody
PAab00636 100 ug
EUR 355
pENTR223-ASGR2 vector
PVT11940 2 ug
EUR 308
Anti-ASGR2 antibody
STJ28203 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-ASGR2 antibody
STJ113409 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-ASGR2 antibody
STJ115884 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.