Human CST4(Cystatin 4) ELISA Kit

Human CST4(Cystatin 4) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Cystatin 4 (CST4) ELISA Kit
RD-CST4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Cystatin 4 (CST4)ELISA Kit
201-12-2805	SunredBio	96 tests	EUR 440
This Cystatin 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 4 (CST4) ELISA Kit
20-abx151234	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin 4(CST4)ELISA Kit
QY-E04222	Qayee Biotechnology	96T	EUR 361

Human Cystatin 4 ELISA Kit (CST4)
RK01201	Abclonal	96 Tests	EUR 521

Human Cystatin 4 (CST4) ELISA Kit
SEJ324Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit
SEJ324Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit
SEJ324Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit
SEJ324Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystatin 4 (CST4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystatin 4 (CST4) in serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cystatin 4 (CST4) ELISA Kit
4-SEJ324Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cystatin 4 elisa. Alternative names of the recognized antigen: Cystatin S Salivary acidic protein 1 Cystatin-SA-III
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cystatin 4 (CST4) in samples from serum, plasma, saliva, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cystatin 4 (CST4) Antibody
20-abx213436	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cystatin 4 (CST4) Antibody
20-abx100492	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Cystatin 4 (CST4) Antibody
20-abx100493	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody
20-abx339840	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Cystatin 4 (CST4)
4-RPJ324Hu01	Cloud-Clone	EUR 350.88 EUR 197.00 EUR 1040.80 EUR 413.60 EUR 727.20 EUR 298.00 EUR 2452.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01036 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Cystatin 4 expressed in: E.coli

ELISA kit for Human CST4 (Cystatin 4)
ELK3152	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cystatin 4 (CST4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cystatin 4 (CST4 Show more
Description: A sandwich ELISA kit for detection of Cystatin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cystatin 4 (CST4) CLIA Kit
20-abx495681	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Cystatin 4 (CST4) Protein
20-abx066237	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody (Biotin)
20-abx272424	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody Pair
20-abx370284	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-7 working days.

Cystatin 4 (CST4) Antibody (FITC)
20-abx273567	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Cystatin 4 (CST4) Monoclonal Antibody (Human)
4-MAJ324Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4)

CST4 Cystatin 4 Human Recombinant Protein
PROTP01036	BosterBio	Regular: 20ug	EUR 317
Description: CST4 Human Recombinant produced in E. coli is a single polypeptide chain containing 145 amino acids (21-141) and having a molecular mass of 16.8kDa.;CST4 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Cystatin 4 (CST4) Polyclonal Antibody (Human)
4-PAJ324Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4)

Human CST4/ Cystatin-S ELISA Kit
E0583Hu	Sunlong	1 Kit	EUR 605

Human Cystatin S(CST4) ELISA kit
E01C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin S(CST4) ELISA kit
E01C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin S(CST4) ELISA kit
E01C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin- S, CST4 ELISA KIT
ELI-08962h	Lifescience Market	96 Tests	EUR 824

Human Cystatin-S (CST4) ELISA Kit
abx570711-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Cystatin 4 (CST4) Monoclonal Antibody (Human), APC
4-MAJ324Hu21-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC.

Cystatin 4 (CST4) Monoclonal Antibody (Human), Biotinylated
4-MAJ324Hu21-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Biotin.

Cystatin 4 (CST4) Monoclonal Antibody (Human), Cy3
4-MAJ324Hu21-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Cy3.

Cystatin 4 (CST4) Monoclonal Antibody (Human), FITC
4-MAJ324Hu21-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with FITC.

Cystatin 4 (CST4) Monoclonal Antibody (Human), HRP
4-MAJ324Hu21-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with HRP.

Cystatin 4 (CST4) Monoclonal Antibody (Human), PE
4-MAJ324Hu21-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with PE.

Cystatin 4 (CST4) Polyclonal Antibody (Human), APC
4-PAJ324Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC.

Cystatin 4 (CST4) Polyclonal Antibody (Human), Biotinylated
4-PAJ324Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Biotin.

Cystatin 4 (CST4) Polyclonal Antibody (Human), Cy3
4-PAJ324Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with Cy3.

Cystatin 4 (CST4) Polyclonal Antibody (Human), FITC
4-PAJ324Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with FITC.

Cystatin 4 (CST4) Polyclonal Antibody (Human), HRP
4-PAJ324Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with HRP.

Cystatin 4 (CST4) Polyclonal Antibody (Human), PE
4-PAJ324Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with PE.

CST4 Human, Cystatin 4 Human Recombinant Protein, sf9
PROTP01036-1	BosterBio	Regular: 10ug	EUR 317
Description: CST4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 131 amino acids (21-141 a.a.) and having a molecular mass of 15.4kDa (Migrates at 13.5-18kDa on SDS-PAGE under reducing conditions).

Human Cystatin-S (CST4) AssayMax ELISA Kit
EC2442-1	AssayPro	96 Well Plate	EUR 417

Rat Cystatin S(CST4) ELISA kit
E02C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin S(CST4) ELISA kit
E02C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin S(CST4) ELISA kit
E02C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit
E03C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit
E03C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cystatin S(CST4) ELISA kit
E03C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cystatin S(CST4) ELISA kit
E06C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cystatin S(CST4) ELISA kit
E06C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cystatin S(CST4) ELISA kit
E06C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit
E04C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit
E04C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cystatin S(CST4) ELISA kit
E04C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit
E09C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit
E09C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cystatin S(CST4) ELISA kit
E09C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit
E08C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit
E08C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cystatin S(CST4) ELISA kit
E08C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit
E07C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit
E07C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cystatin S(CST4) ELISA kit
E07C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cystatin-S (CST4) ELISA Kit
abx556213-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Cystatin 4 (CST4) Monoclonal Antibody (Human), APC-Cy7
4-MAJ324Hu21-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser21~Ala141 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC-Cy7.

Cystatin 4 (CST4) Polyclonal Antibody (Human), APC-Cy7
4-PAJ324Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CST4 (Ser21~Ala141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cystatin 4 (CST4). This antibody is labeled with APC-Cy7.

Human Cystatin-S (CST4) Antibody
32026-05111	AssayPro	150 ug	EUR 261

Cystatin S (CST4) Antibody
20-abx005688	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cystatin S (CST4) Antibody
abx145061-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Cystatin S (CST4) Antibody
20-abx320455	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Cst4 ELISA Kit\| Rat Cystatin-S ELISA Kit
EF018524	Lifescience Market	96 Tests	EUR 689

Guinea pig Cystatin S(CST4) ELISA kit
E05C2123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cystatin S(CST4) ELISA kit
E05C2123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cystatin S(CST4) ELISA kit
E05C2123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cystatin S(CST4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cst4/ Rat Cst4 ELISA Kit
ELI-31049r	Lifescience Market	96 Tests	EUR 886

Human Cystatin-S (CST4) Antibody (Biotin Conjugate)
32026-05121	AssayPro	150 ug	EUR 369

Recombinant Human Cystatin S/CST4 (C-6His)
C335-10ug	Novoprotein	10ug	EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)
C335-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)
C335-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

Recombinant Human Cystatin S/CST4 (C-6His)
C335-50ug	Novoprotein	50ug	EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, pH 5.5.

CST4 ELISA KIT\|Human
EF004811	Lifescience Market	96 Tests	EUR 689

Human Cystatin-S (CST4) AssayLite Antibody (FITC Conjugate)
32026-05141	AssayPro	150 ug	EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (RPE Conjugate)
32026-05151	AssayPro	150 ug	EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (APC Conjugate)
32026-05161	AssayPro	150 ug	EUR 428

Human Cystatin-S (CST4) AssayLite Antibody (PerCP Conjugate)
32026-05171	AssayPro	150 ug	EUR 471

CST4 ELISA Kit (Human) (OKAN06115)
OKAN06115	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.066 ng/mL

CST4 ELISA Kit (Human) (OKCD00564)
OKCD00564	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: This protein strongly inhibits papain and ficin, partially inhibits stem bromelain and bovine cathepsin C, but does not inhibit porcine cathepsin B or clostripain. Papain is inhibited non-competitively. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

CST4 ELISA Kit (Human) (OKDD00214)
OKDD00214	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.053 ng/mL

CST4 ELISA Kit (Human) (OKEH07972)
OKEH07972	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33ng/mL

Cystatin 4 Protein
20-abx260889	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CST3 Mouse, Cystatin-C Mouse Recombinant Protein, Active
PROTP21460-4	BosterBio	Regular: 10ug	EUR 317
Description: CST3 Mouse produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 126 amino acids (21-140 a.a.) and having a molecular mass of 14.2kDa (Molecular size on SDS-PAGE will appear at approximately 13.5-18kDa).;CST3 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

CST4 Antibody
36216-100ul	SAB	100ul	EUR 252

CST4 antibody
10R-6877	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody
10R-6878	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody
10R-6879	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 antibody
10R-6880	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CST4 antibody

CST4 Antibody
1-CSB-PA006092ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CST4 Antibody
1-CSB-PA374612	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CST4 Antibody
1-CSB-PA437759	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CST4. Recognizes CST4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CST4 siRNA
20-abx913003	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CST4 siRNA
20-abx913004	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T	DL Develop	48T	EUR 479
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T	DL Develop	96T	EUR 621
Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human CST4 shRNA Plasmid
20-abx951040	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CST4 Recombinant Protein (Human)
RP008224	ABM	100 ug	Ask for price

Human Cystatin C ELISA kit
55R-1733	Fitzgerald	1 kit	EUR 651
Description: ELISA kit for the detection of Cystatin C in the research laboratory

Human Cystatin C ELISA Kit
DEIA2709	Creative Diagnostics	96T	EUR 876
Description: For the quantitative determination of human Cystatin C concentrations in cell culture supernates, serum, plasma, saliva, urine, and human milk.

Human Cystatin A ELISA kit
E01C0350-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin A ELISA kit
E01C0350-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin A ELISA kit
E01C0350-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit
E01C0868-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit
E01C0868-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C ELISA kit
E01C0868-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin C in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cystatin F ELISA KIT\|Human
EF008979	Lifescience Market	96 Tests	EUR 689

Human Cystatin C ELISA kit
LF-EK50565	Abfrontier	1Ã—96T	EUR 648

Human FibrOut 4, for brain, neural
4-21552	CHI Scientific	1 ml	Ask for price

Human FibrOut 4, for brain, neural
4-21553	CHI Scientific	5 x 1 ml	Ask for price

Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4	BosterBio	20ug	EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4	BosterBio	20ug	EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

CST4 Conjugated Antibody
C36216	SAB	100ul	EUR 397

CST4 cloning plasmid
CSB-CL006092HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 426 Sequence: atggcccggcctctgtgtaccctgctactcctgatggctaccctggctggggctctggcctcgagctccaaggaggagaataggataatcccaggtggcatctatgatgcagacctcaatgatgagtgggtacagcgtgcccttcacttcgccatcagcgagtacaacaaggccac Show more
Description: A cloning plasmid for the CST4 gene.

CST4 Rabbit pAb
A8114-100ul	Abclonal	100 ul	EUR 308

CST4 Rabbit pAb
A8114-200ul	Abclonal	200 ul	EUR 459

CST4 Rabbit pAb
A8114-20ul	Abclonal	20 ul	EUR 183

CST4 Rabbit pAb
A8114-50ul	Abclonal	50 ul	EUR 223

Anti-CST4 antibody
STJ110413	St John's Laboratory	100 µl	EUR 277
Description: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a type 2 salivary cysteine peptidase inhibitor. The protein is an S-type cystatin, based on its high level of expression in saliva, tears and seminal plasma. The specific role in these fluids is unclear but antibacterial and antiviral activity is present, consistent with a protective function.

Human Cystatin 1 (CST1)ELISA Kit
201-12-2802	SunredBio	96 tests	EUR 440
This Cystatin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 11 (CST11)ELISA Kit
201-12-2803	SunredBio	96 tests	EUR 440
This Cystatin 11 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 2 (CST2)ELISA Kit
201-12-2804	SunredBio	96 tests	EUR 440
This Cystatin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 5 (CST5)ELISA Kit
201-12-2806	SunredBio	96 tests	EUR 440
This Cystatin 5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 6 (CST6)ELISA Kit
201-12-2807	SunredBio	96 tests	EUR 440
This Cystatin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 7 (CST7)ELISA Kit
201-12-2808	SunredBio	96 tests	EUR 440
This Cystatin 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 8 (CST8)ELISA Kit
201-12-2809	SunredBio	96 tests	EUR 440
This Cystatin 8 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin B (CSTB)ELISA Kit
201-12-2810	SunredBio	96 tests	EUR 440
This Cystatin B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystatin 1 (CST1) ELISA Kit
DLR-CST1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Cystatin 1 (CST1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 1 (CST1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 1 (CST1) ELISA Kit
DLR-CST1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Cystatin 1 (CST1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 1 (CST1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 2 (CST2) ELISA Kit
DLR-CST2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Cystatin 2 (CST2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 2 (CST2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 2 (CST2) ELISA Kit
DLR-CST2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Cystatin 2 (CST2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 2 (CST2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 3 (CST3) ELISA Kit
DLR-CST3-Hu-48T	DL Develop	48T	EUR 380
Should the Human Cystatin 3 (CST3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 3 (CST3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 3 (CST3) ELISA Kit
DLR-CST3-Hu-96T	DL Develop	96T	EUR 485
Should the Human Cystatin 3 (CST3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 3 (CST3) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin 6 (CST6) ELISA Kit
DLR-CST6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Cystatin 6 (CST6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 6 (CST6) in samples from serum, plasma, tissue homogenates, sweat, cell culture supernates or other biological fluids.

Human Cystatin 6 (CST6) ELISA Kit
DLR-CST6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Cystatin 6 (CST6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin 6 (CST6) in samples from serum, plasma, tissue homogenates, sweat, cell culture supernates or other biological fluids.

Human Cystatin A (CSTA) ELISA Kit
DLR-CSTA-Hu-48T	DL Develop	48T	EUR 479
Should the Human Cystatin A (CSTA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin A (CSTA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin A (CSTA) ELISA Kit
DLR-CSTA-Hu-96T	DL Develop	96T	EUR 621
Should the Human Cystatin A (CSTA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin A (CSTA) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cystatin B (CSTB) ELISA Kit
DLR-CSTB-Hu-48T	DL Develop	48T	EUR 517
Should the Human Cystatin B (CSTB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin B (CSTB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Cystatin B (CSTB) ELISA Kit
DLR-CSTB-Hu-96T	DL Develop	96T	EUR 673
Should the Human Cystatin B (CSTB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystatin B (CSTB) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human CST3/ Cystatin-C ELISA Kit
E0582Hu	Sunlong	1 Kit	EUR 537

Human CST5/ Cystatin-D ELISA Kit
E0584Hu	Sunlong	1 Kit	EUR 605

Human CST9/ Cystatin-9 ELISA Kit
E0585Hu	Sunlong	1 Kit	EUR 571

Human CSTA/ Cystatin-A ELISA Kit
E0586Hu	Sunlong	1 Kit	EUR 571

Human Cystatin SN(CST1) ELISA kit
E01C2119-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SN(CST1) ELISA kit
E01C2119-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SN(CST1) ELISA kit
E01C2119-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SN(CST1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit
E01C2120-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit
E01C2120-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 11(CST11) ELISA kit
E01C2120-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 11(CST11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit
E01C2121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit
E01C2121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin SA(CST2) ELISA kit
E01C2121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin SA(CST2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit
E01C2124-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit
E01C2124-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin D(CST5) ELISA kit
E01C2124-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin D(CST5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit
E01C2125-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit
E01C2125-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin M(CST6) ELISA kit
E01C2125-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin M(CST6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit
E01C2126-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit
E01C2126-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin F(CST7) ELISA kit
E01C2126-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin F(CST7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit
E01C2127-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit
E01C2127-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 8(CST8) ELISA kit
E01C2127-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 8(CST8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit
E01C2128-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit
E01C2128-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin 9(CST9) ELISA kit
E01C2128-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystatin 9(CST9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystatin C (CST3) ELISA Kit
abx050049-96tests	Abbexa	96 tests	EUR 770
Shipped within 5-10 working days.

Human Cystatin 1 (CST1) ELISA Kit
20-abx151231	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin 2 (CST2) ELISA Kit
20-abx151232	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin 3 (CST3) ELISA Kit
20-abx151233	Abbexa	EUR 5311.00 EUR 2837.00 EUR 668.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin 6 (CST6) ELISA Kit
20-abx151235	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin A (CSTA) ELISA Kit
20-abx151236	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin B (CSTB) ELISA Kit
20-abx151237	Abbexa	EUR 5640.00 EUR 3009.00 EUR 707.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin A (CSTA) ELISA Kit
abx253875-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Cystatin D (CST5) ELISA Kit
20-abx258835	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cystatin F (CST7) ELISA Kit
abx259522-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Cystatin 9 (CST9) ELISA Kit
abx250856-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Cystatin-A
EK1817	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-A in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Cystatin-C
EK2417	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-C in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Cystatin-D
EK3313	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystatin-D in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Cystatin C PicoKine ELISA Kit
EK0678	BosterBio	96 wells	EUR 456
Description: For quantitative detection of Human Cystatin C in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human Cystatin B PicoKine ELISA Kit
EK1205	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Cystatin B in cell culture supernates, serum, plasma(heparin, EDTA), saliva, urine and human milk.

Human CSTB/ Cystatin-B ELISA Kit
E2763Hu	Sunlong	1 Kit	EUR 537

Cystatin C (CST3) (Human) ELISA Kit
E4304-100	Biovision		EUR 588

Human CSTB(Cystatin B) ELISA Kit
EH0109	FN Test	96T	EUR 524.1
Detection range: 1.56-100 ng/ml Uniprot ID: P04080 Alias: Cystatin B/CSTB/Stefin-B/CPI-B/PME/EPM1/Liver thiol proteinase inhibitor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human CST3(Cystatin C) ELISA Kit
EH0110	FN Test	96T	EUR 476.25
Detection range: 0.313-20 ng/ml Uniprot ID: P01034 Alias: Cystatin C/CST3/Cys-C/Cystatin 3/ARMD11/Post-Gamma-Globulin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CSTA(Cystatin-A) ELISA Kit
EH0919	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P01040 Alias: CSTA/Cystatin-A/Keratolinin/Stefin A//STF1/cystatin A/cystatin AS/Cystatin-AS/STFA/Stefin-A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human CST9(Cystatin-9) ELISA Kit
EH1567	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q5W186 Alias: CST9/Cystatin-9/Cystatin-like molecule/CLM
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Cystatin- 8, CST8 ELISA KIT
ELI-10130h	Lifescience Market	96 Tests	EUR 824

Human Cystatin- C, CST3 ELISA KIT
ELI-03009h	Lifescience Market	96 Tests	EUR 824