Human AGK(Acylglycerol Kinase) ELISA Kit

Human AGK(Acylglycerol Kinase) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Acylglycerol Kinase (AGK) ELISA Kit
RDR-AGK-Hu-96Tests 96 Tests
EUR 756
Human Acylglycerol Kinase (AGK) ELISA Kit
20-abx150540
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.
Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.
Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.
Human Acylglycerol Kinase (AGK) ELISA Kit
SEG236Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acylglycerol Kinase (AGK) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acylglycerol Kinase (AGK) in Tissue homogenates and other biological fluids.
Human Acylglycerol Kinase (AGK) ELISA Kit
4-SEG236Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acylglycerol Kinase elisa. Alternative names of the recognized antigen: MULK
  • Multiple Substrate Lipid Kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acylglycerol Kinase (AGK) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Acylglycerol Kinase (AGK) Antibody
abx036608-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Acylglycerol Kinase (AGK) Antibody
20-abx131353
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Acylglycerol Kinase (AGK) Antibody
20-abx135896
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Acylglycerol Kinase (AGK) Antibody
20-abx148048
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylglycerol Kinase (AGK) Antibody
20-abx171072
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Acylglycerol Kinase (AGK) Antibody
abx432131-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Recombinant Acylglycerol Kinase (AGK)
4-RPG236Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q53H12
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Acylglycerol Kinase expressed in: E.coli
Human Acylglycerol Kinase (AGK) Protein
20-abx650682
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Acylglycerol Kinase (AGK) CLIA Kit
20-abx495134
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E01A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylglycerol kinase, mitochondrial, AGK ELISA KIT
ELI-24573h 96 Tests
EUR 824
ELISA kit for Human AGK (Acylglycerol Kinase)
ELK3404 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acylglycerol Kinase (AGK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylglyc
  • Show more
Description: A sandwich ELISA kit for detection of Acylglycerol Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E02A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E06A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E03A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E04A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E07A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E08A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E09A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylglycerol kinase, mitochondrial, Agk ELISA KIT
ELI-11913m 96 Tests
EUR 865
Acylglycerol Kinase, Mitochondrial (AGK) Antibody
20-abx317853
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human Acylglycerol kinase, mitochondrial (AGK)
KTE60963-48T 48T
EUR 332
  • MULK contains an N-terminal diacylglycerol (DG) kinase domain, a putative nuclear localization signal, and a region with 44% homology to SPHK2. Comparison of putative vertebrate MULK orthologs showed strong conservation of amino acid sequences, and p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Acylglycerol kinase, mitochondrial (AGK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Acylglycerol kinase, mitochondrial (AGK)
KTE60963-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MULK contains an N-terminal diacylglycerol (DG) kinase domain, a putative nuclear localization signal, and a region with 44% homology to SPHK2. Comparison of putative vertebrate MULK orthologs showed strong conservation of amino acid sequences, and p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Acylglycerol kinase, mitochondrial (AGK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Acylglycerol kinase, mitochondrial (AGK)
KTE60963-96T 96T
EUR 539
  • MULK contains an N-terminal diacylglycerol (DG) kinase domain, a putative nuclear localization signal, and a region with 44% homology to SPHK2. Comparison of putative vertebrate MULK orthologs showed strong conservation of amino acid sequences, and p
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Acylglycerol kinase, mitochondrial (AGK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Guinea pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E05A1324-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E05A1324-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Acylglycerol kinase, mitochondrial(AGK) ELISA kit
E05A1324-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acylglycerol kinase, mitochondrial(AGK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (HRP)
20-abx314524
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (FITC)
20-abx314525
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylglycerol Kinase, Mitochondrial (AGK) Antibody (Biotin)
20-abx314526
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse)
4-PAG236Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK)
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC
4-PAG236Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG236Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Biotin.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG236Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with Cy3.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), FITC
4-PAG236Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with FITC.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), HRP
4-PAG236Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with HRP.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), PE
4-PAG236Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with PE.
Acylglycerol Kinase (AGK) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG236Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AGK (Thr15~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Acylglycerol Kinase (AGK). This antibody is labeled with APC-Cy7.
anti-Acylglycerol Kinase
YF-PA19817 50 ul
EUR 363
Description: Mouse polyclonal to Acylglycerol Kinase
anti-Acylglycerol Kinase
YF-PA19818 50 ug
EUR 363
Description: Mouse polyclonal to Acylglycerol Kinase
Anti-Acylglycerol kinase antibody
STJ71283 100 µg
EUR 359
AGK ELISA Kit (Human) (OKCD00496)
OKCD00496 96 Wells
EUR 831
Description: Description of target: Lipid kinase that can phosphorylate both monoacylglycerol and diacylglycerol to form lysophosphatidic acid (LPA) and phosphatidic acid (PA), respectively. Does not phosphorylate sphingosine. Overexpression increases the formation and secretion of LPA, resulting in transactivation of EGFR and activation of the downstream MAPK signaling pathway, leading to increased cell growth.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"A novel acylglycerol kinase that produces lysophosphatidic acid modulates cross talk with EGFR in prostate cancer cells."_x005F_x005F_x000D_Bektas M., Payne S.G., Liu H., Goparaju S., Milstien S., Spiegel S._x005F_x005F_x000D_J. Cell Biol. 169:801-811(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, COFACTOR, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.081 ng/mL
AGK ELISA Kit (Human) (OKDD00117)
OKDD00117 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.081 ng/mL
Polyclonal Goat Anti-Acylglycerol kinase Antibody
AMM04864G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Acylglycerol kinase . This antibody is tested and proven to work in the following applications:
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
AGK Antibody
45528-100ul 100ul
EUR 252
AGK Antibody
45528-50ul 50ul
EUR 187
AGK Antibody
1-CSB-PA706634LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
AGK Antibody
DF8835 200ul
EUR 304
Description: AGK Antibody detects endogenous levels of total AGK.
AGK antibody
70R-3532 50 ug
EUR 467
Description: Rabbit polyclonal AGK antibody raised against the N terminal of AGK
AGK antibody
70R-9479 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AGK antibody
AGK 2
B7323-10 10 mg
EUR 273
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.
AGK 2
B7323-5.1 10 mM (in 1mL DMSO)
EUR 247
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.
AGK 2
B7323-50 50 mg
EUR 986
Description: AGK 2 is a potent and selective inhibitor of sirtuin 2 with IC50 value of 3.5 ?M [1]. Sirtuin 2 (SIRT2) is a NAD-dependent deacetylase and is involved in cell cycle regulation through ?-tubulin deacetylation.
AGK siRNA
20-abx906999
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AGK siRNA
20-abx907000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AGK Antibody
ABD8835 100 ug
EUR 438
pENTR223- AGK
PVT10006 2 ug
EUR 266
pCDNA3.1- AGK
PVT10259 2 ug
EUR 301
Human 2 acylglycerol O acyltransferase 1 ELISA kit
E01M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 2 acylglycerol O acyltransferase 1 ELISA kit
E01M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 2 acylglycerol O acyltransferase 1 ELISA kit
E01M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AGK shRNA Plasmid
20-abx960887
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
AGK Recombinant Protein (Human)
RP000730 100 ug Ask for price
AGK Recombinant Protein (Human)
RP000733 100 ug Ask for price
Human 2- acylglycerol O- acyltransferase 3, MOGAT3 ELISA KIT
ELI-14125h 96 Tests
EUR 824
Human 2- acylglycerol O- acyltransferase 1, MOGAT1 ELISA KIT
ELI-16547h 96 Tests
EUR 824
Human 2-acylglycerol O-acyltransferase 1 (MOGAT1) ELISA Kit
abx381489-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human 2- acylglycerol O- acyltransferase 2, MOGAT2 ELISA KIT
ELI-38579h 96 Tests
EUR 824
AGK Monoclonal Antibody
29784-100ul 100ul
EUR 252
AGK Monoclonal Antibody
29784-50ul 50ul
EUR 187
AGK Mouse mAb
A16230-100ul 100 ul
EUR 384
AGK Mouse mAb
A16230-200ul 200 ul
EUR 554
AGK Mouse mAb
A16230-20ul 20 ul
EUR 183
AGK Mouse mAb
A16230-50ul 50 ul
EUR 265
AGK Blocking Peptide
33R-2085 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-9479
AGK Blocking Peptide
33R-4482 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGK antibody, catalog no. 70R-3532
AGK Blocking Peptide
DF8835-BP 1mg
EUR 195
AGK Conjugated Antibody
C45528 100ul
EUR 397
AGK cloning plasmid
CSB-CL706634HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 198
  • Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcagcactatcaggatgaatcacgctgggagccaactct
  • Show more
Description: A cloning plasmid for the AGK gene.
AGK cloning plasmid
CSB-CL706634HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgacggtgttctttaaaacgcttcgaaatcactggaagaaaactacagctgggctctgcctgctgacctggggaggccattggctctatggaaaacactgtgataacctcctaaggagagcagcctgtcaagaagctcaggtgtttggcaatcaactcattcctcccaatgcac
  • Show more
Description: A cloning plasmid for the AGK gene.
AGK Rabbit pAb
A9976-100ul 100 ul
EUR 308
AGK Rabbit pAb
A9976-200ul 200 ul
EUR 459
AGK Rabbit pAb
A9976-20ul 20 ul
EUR 183
AGK Rabbit pAb
A9976-50ul 50 ul
EUR 223
AGK Polyclonal Antibody
ABP57726-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
AGK Polyclonal Antibody
ABP57726-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
AGK Polyclonal Antibody
ABP57726-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
  • Applications tips:
Description: A polyclonal antibody for detection of AGK from Human, Mouse. This AGK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AGK protein at amino acid sequence of 330-410
AGK Polyclonal Antibody
ES9068-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
AGK Polyclonal Antibody
ES9068-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AGK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
pT7- His- AGK
PVT10121 2 ug
EUR 301
pDONR223- AGK Plasmid
PVT7100 2 ug
EUR 266
Anti-AGK antibody
STJ112017 100 µl
EUR 277
Description: The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10.
Anti-AGK antibody
STJ118682 100 µl
EUR 393
Anti-AGK antibody
STJ190226 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AGK
AGK ORF Vector (Human) (pORF)
ORF000244 1.0 ug DNA
EUR 95
AGK ORF Vector (Human) (pORF)
ORF000245 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Rat 2 acylglycerol O acyltransferase 1 ELISA kit
E02M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 2 acylglycerol O acyltransferase 1 ELISA kit
E02M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat 2 acylglycerol O acyltransferase 1 ELISA kit
E02M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 2 acylglycerol O acyltransferase 1 ELISA kit
E04M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 2 acylglycerol O acyltransferase 1 ELISA kit
E04M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 2 acylglycerol O acyltransferase 1 ELISA kit
E04M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 2 acylglycerol O acyltransferase 1 ELISA kit
E03M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 2 acylglycerol O acyltransferase 1 ELISA kit
E03M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse 2 acylglycerol O acyltransferase 1 ELISA kit
E03M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 2 acylglycerol O acyltransferase 1 ELISA kit
E06M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 2 acylglycerol O acyltransferase 1 ELISA kit
E06M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat 2 acylglycerol O acyltransferase 1 ELISA kit
E06M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 2 acylglycerol O acyltransferase 1 ELISA kit
E08M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 2 acylglycerol O acyltransferase 1 ELISA kit
E08M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog 2 acylglycerol O acyltransferase 1 ELISA kit
E08M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 2 acylglycerol O acyltransferase 1 ELISA kit
E07M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 2 acylglycerol O acyltransferase 1 ELISA kit
E07M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig 2 acylglycerol O acyltransferase 1 ELISA kit
E07M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 2 acylglycerol O acyltransferase 1 ELISA kit
E09M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 2 acylglycerol O acyltransferase 1 ELISA kit
E09M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey 2 acylglycerol O acyltransferase 1 ELISA kit
E09M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
ELISA kit for Human 2-acylglycerol O-acyltransferase 2 (MOGAT2)
KTE62227-48T 48T
EUR 332
  • MOGAT2 contains a phosphate acyltransferase-like domain and 2 predicted N-linked glycosylation sites. Northern blot analysis revealed expression of 7.2-, 3.0-, and 1.3-kb transcripts in liver, stomach, and small intestine, with lower expression in co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 2-acylglycerol O-acyltransferase 2 (MOGAT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human 2-acylglycerol O-acyltransferase 2 (MOGAT2)
KTE62227-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MOGAT2 contains a phosphate acyltransferase-like domain and 2 predicted N-linked glycosylation sites. Northern blot analysis revealed expression of 7.2-, 3.0-, and 1.3-kb transcripts in liver, stomach, and small intestine, with lower expression in co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 2-acylglycerol O-acyltransferase 2 (MOGAT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human 2-acylglycerol O-acyltransferase 2 (MOGAT2)
KTE62227-96T 96T
EUR 539
  • MOGAT2 contains a phosphate acyltransferase-like domain and 2 predicted N-linked glycosylation sites. Northern blot analysis revealed expression of 7.2-, 3.0-, and 1.3-kb transcripts in liver, stomach, and small intestine, with lower expression in co
  • Show more
Description: Quantitative sandwich ELISA for measuring Human 2-acylglycerol O-acyltransferase 2 (MOGAT2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
AGK Antibody, HRP conjugated
1-CSB-PA706634LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
AGK Antibody, FITC conjugated
1-CSB-PA706634LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
AGK Antibody, Biotin conjugated
1-CSB-PA706634LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGK. Recognizes AGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse AGK shRNA Plasmid
20-abx977092
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
AGK Monoclonal Conjugated Antibody
C29784 100ul
EUR 397
AGK Recombinant Protein (Mouse)
RP114779 100 ug Ask for price
AGK Recombinant Protein (Rat)
RP189512 100 ug Ask for price
AGK sgRNA CRISPR Lentivector set (Human)
K0058001 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Guinea pig 2 acylglycerol O acyltransferase 1 ELISA kit
E05M0446-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig 2 acylglycerol O acyltransferase 1 ELISA kit
E05M0446-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig 2 acylglycerol O acyltransferase 1 ELISA kit
E05M0446-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig 2 acylglycerol O acyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Bovine 2- acylglycerol O- acyltransferase 1, MOGAT1 ELISA KIT
ELI-20900b 96 Tests
EUR 928
Mouse 2- acylglycerol O- acyltransferase 2, Mogat2 ELISA KIT
ELI-23442m 96 Tests
EUR 865
Mouse 2- acylglycerol O- acyltransferase 1, Mogat1 ELISA KIT
ELI-42807m 96 Tests
EUR 865
Mouse 2-acylglycerol O-acyltransferase 1 (MOGAT1) ELISA Kit
abx389920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) ELISA kit
E01A0926-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) ELISA kit
E01A0926-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) ELISA kit
E01A0926-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 1 acylglycerol 3 phosphate O acyltransferase ABHD5(ABHD5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human 1-Acylglycerol-3-Phosphate O-Acyltransferase 1 (AGPAT1) ELISA Kit
20-abx392194
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human 1-Acylglycerol-3-Phosphate O-Acyltransferase 2 (AGPAT2) ELISA Kit
abx384520-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human 1-Acylglycerol-3-Phosphate O-Acyltransferase 3 (AGPAT3) ELISA Kit
20-abx385661
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9