Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

To Order Contact us:

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

RDR-PAEP-Hu-48Tests 48 Tests
EUR 544

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

RDR-PAEP-Hu-96Tests 96 Tests
EUR 756

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

RD-PAEP-Hu-48Tests 48 Tests
EUR 521

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

RD-PAEP-Hu-96Tests 96 Tests
EUR 723

Progestagen-Associated Endometrial Protein (PAEP) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

abx028157-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

abx028157-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Progestagen Associated Endometrial Protein (PAEP) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Progestagen Associated Endometrial Protein (PAEP) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Progestagen Associated Endometrial Protein (PAEP) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Progestagen Associated Endometrial Protein(PAEP)ELISA Kit

QY-E01907 96T
EUR 361

Human Progestagen Associated Endometrial Protein ELISA Kit (PAEP)

RK02007 96 Tests
EUR 521

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

SEC709Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

SEC709Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

SEC709Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

SEC709Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Progestagen Associated Endometrial Protein elisa. Alternative names of the recognized antigen: GD
  • GdA
  • GdF
  • GdS
  • PAEG
  • PEP
  • PP14
  • Glycodelin
  • Placental Protein 14
  • Alpha Uterine Protein
  • Pregnancy-Associated Endometrial Alpha-2-Globuli
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Monkey Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit

abx359635-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit

abx361451-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit

abx362423-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit

abx356335-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit

abx364352-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Human Progestagen-Associated Endometrial Protein (PAEP) CLIA Kit

abx197540-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Progestagen Associated Endometrial Protein (PAEP) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human PAEP (Progestagen Associated Endometrial Protein)

ELK3531 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Progestagen Associated Endometrial Protein (PAEP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antib
  • Show more
Description: A sandwich ELISA kit for detection of Progestagen Associated Endometrial Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)

KTE61318-48T 48T
EUR 354
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)

KTE61318-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)

KTE61318-96T 96T
EUR 572
  • Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PAEP Progesterone-Associated Endometrial Protein Human Recombinant Protein

PROTP09466 Regular: 10ug
EUR 317
Description: PAEP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (19-180a.a) and having a molecular mass of 21kDa. ;PAEP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.


ELA-E10200h 96 Tests
EUR 824


EF002066 96 Tests
EUR 689

Human Glycodelin (PAEP) ELISA Kit

abx250392-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human PAEP/ Glycodelin ELISA Kit

E1860Hu 1 Kit
EUR 605

Human PAEP(Glycodelin) ELISA Kit

EH1142 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P09466
  • Alias: PAEP(Progestagen-Associated Endometrial Protein)/Glycodelin/PP14/alpha uterine protein/GdF/GdS/glycodelin-A/glycodelin-F/glycodelin-S/PEP/Placental protein 14/Pregnancy-associated endometrial
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Glycodelin, PAEP ELISA KIT

ELI-03273h 96 Tests
EUR 824

PAEP ELISA Kit (Human) (OKCD08232)

OKCD08232 96 Wells
EUR 975
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.1ng/mL

PAEP ELISA Kit (Human) (OKAN05291)

OKAN05291 96 Wells
EUR 792
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.1 ng/mL

PAEP Recombinant Protein (Human)

RP022438 100 ug Ask for price

Human Glycodelin (PAEP)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli

Human Glycodelin (PAEP)

  • EUR 358.00
  • EUR 1257.00
  • EUR 514.00
  • EUR 927.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 23.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell

PAEP ELISA Kit (Bovine) (OKAN06339)

OKAN06339 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL

Human Endometrial Adenocarcinoma CAFs

CAF01 1,000,000 cells
EUR 1223

PAEP Antibody

33016-100ul 100ul
EUR 252

PAEP Antibody

DF2701 200ul
EUR 304
Description: PAEP antibody detects endogenous levels of total PAEP.

PAEP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

PAEP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300

PAEP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAEP Antibody

ABD2701 100 ug
EUR 438

PAEP ELISA Kit (Human) : 96 Wells (OKEH02065)

OKEH02065 96 Wells
EUR 662
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL

PAEP protein (His tag)

80R-2711 50 ug
EUR 424
Description: Purified recombinant PAEP protein (His tag)

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human PAEP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PAEP Rabbit pAb

A11810-100ul 100 ul
EUR 308

PAEP Rabbit pAb

A11810-200ul 200 ul
EUR 459

PAEP Rabbit pAb

A11810-20ul 20 ul Ask for price

PAEP Rabbit pAb

A11810-50ul 50 ul Ask for price

PAEP Rabbit pAb

A14757-100ul 100 ul
EUR 308

PAEP Rabbit pAb

A14757-200ul 200 ul
EUR 459

PAEP Rabbit pAb

A14757-20ul 20 ul
EUR 183

PAEP Rabbit pAb

A14757-50ul 50 ul
EUR 223

PAEP Blocking Peptide

DF2701-BP 1mg
EUR 195

PAEP Conjugated Antibody

C33016 100ul
EUR 397

PAEP cloning plasmid

CSB-CL017381HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt
  • Show more
Description: A cloning plasmid for the PAEP gene.

PAEP Rabbit pAb

A5751-100ul 100 ul
EUR 308

PAEP Rabbit pAb

A5751-200ul 200 ul
EUR 459

PAEP Rabbit pAb

A5751-20ul 20 ul
EUR 183

PAEP Rabbit pAb

A5751-50ul 50 ul
EUR 223

PAEP Polyclonal Antibody

ABP59813-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody

ABP59813-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody

ABP59813-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAEP protein
  • Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody

ES10976-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAEP Polyclonal Antibody

ES10976-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PAEP antibody

STJ28318 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody

STJ113389 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody

STJ116957 100 µl
EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody

STJ192134 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAEP

PAEP ORF Vector (Human) (pORF)

ORF007480 1.0 ug DNA
EUR 95

PAEP Protein Vector (Human) (pPB-C-His)

PV029917 500 ng
EUR 329

PAEP Protein Vector (Human) (pPB-N-His)

PV029918 500 ng
EUR 329

PAEP Protein Vector (Human) (pPM-C-HA)

PV029919 500 ng
EUR 329

PAEP Protein Vector (Human) (pPM-C-His)

PV029920 500 ng
EUR 329

Immortalized Human Endometrial Stromal Cells (HESC)

T0533 1x106 cells / 1.0 ml
EUR 1500

Immortalized Human Endometrial Stromal Cells-SV40

T9201 1x106 cells / 1.0 ml
EUR 1500

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PAEP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PAEP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PAEP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PAEP sgRNA CRISPR Lentivector set (Human)

K1587501 3 x 1.0 ug
EUR 339