Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

Human PAEP(Progestagen Associated Endometrial Protein) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RDR-PAEP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
RD-PAEP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Progestagen-Associated Endometrial Protein (PAEP) Protein
20-abx262595	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
abx028157-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx004400	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Progestagen Associated Endometrial Protein (PAEP) Antibody
20-abx178096	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx211693	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx213124	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx126995	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Progestagen Associated Endometrial Protein (PAEP) Antibody
20-abx174167	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody
20-abx301834	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
20-abx152622	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Progestagen Associated Endometrial Protein(PAEP)ELISA Kit
QY-E01907	Qayee Biotechnology	96T	EUR 361

Human Progestagen Associated Endometrial Protein ELISA Kit (PAEP)
RK02007	Abclonal	96 Tests	EUR 521

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
SEC709Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Progestagen Associated Endometrial Protein (PAEP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Progestagen Associated Endometrial Protein (PAEP) in serum, plasma, tissue homogenates and other biological fluids.

Human Progestagen Associated Endometrial Protein (PAEP) ELISA Kit
4-SEC709Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Progestagen Associated Endometrial Protein elisa. Alternative names of the recognized antigen: GD GdA GdF GdS PAEG PEP PP14 Glycodelin Placental Protein 14 Alpha Uterine Protein Pregnancy-Associated Endometrial Alpha-2-Globuli Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Progestagen Associated Endometrial Protein (PAEP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Progestagen Associated Endometrial Protein (PAEP) Protein
20-abx654801	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Monkey Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx359635-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx361451-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx362423-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx356335-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Progestagen-Associated Endometrial Protein (PAEP) ELISA Kit
abx364352-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Human Progestagen-Associated Endometrial Protein (PAEP) CLIA Kit
abx197540-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Progestagen Associated Endometrial Protein (PAEP) CLIA Kit
20-abx493852	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (HRP)
20-abx315904	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (FITC)
20-abx315905	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Progestagen-Associated Endometrial Protein (PAEP) Antibody (Biotin)
20-abx315906	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human PAEP (Progestagen Associated Endometrial Protein)
ELK3531	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Progestagen Associated Endometrial Protein (PAEP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antib Show more
Description: A sandwich ELISA kit for detection of Progestagen Associated Endometrial Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-48T	Abbkine	48T	EUR 354
Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Progestagen Associated Endometrial Protein (PAEP)
KTE61318-96T	Abbkine	96T	EUR 572
Glycodelin is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of Show more
Description: Quantitative sandwich ELISA for measuring Human Progestagen Associated Endometrial Protein (PAEP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PAEP Progesterone-Associated Endometrial Protein Human Recombinant Protein
PROTP09466	BosterBio	Regular: 10ug	EUR 317
Description: PAEP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 185 amino acids (19-180a.a) and having a molecular mass of 21kDa. ;PAEP is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human PAEP ELISA Kit
ELA-E10200h	Lifescience Market	96 Tests	EUR 824

PAEP ELISA KIT|Human
EF002066	Lifescience Market	96 Tests	EUR 689

Human Glycodelin (PAEP) ELISA Kit
abx250392-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human PAEP/ Glycodelin ELISA Kit
E1860Hu	Sunlong	1 Kit	EUR 605

Human PAEP(Glycodelin) ELISA Kit
EH1142	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P09466 Alias: PAEP(Progestagen-Associated Endometrial Protein)/Glycodelin/PP14/alpha uterine protein/GdF/GdS/glycodelin-A/glycodelin-F/glycodelin-S/PEP/Placental protein 14/Pregnancy-associated endometrial Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Glycodelin, PAEP ELISA KIT
ELI-03273h	Lifescience Market	96 Tests	EUR 824

PAEP ELISA Kit (Human) (OKAN05291)
OKAN05291	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.1 ng/mL

PAEP ELISA Kit (Human) (OKCD08232)
OKCD08232	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.1ng/mL

PAEP Recombinant Protein (Human)
RP022438	ABM	100 ug	Ask for price

PAEP ELISA Kit (Bovine) (OKAN06339)
OKAN06339	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL

Human Glycodelin (PAEP)
1-CSB-EP017381HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 22.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in E.coli

Human Glycodelin (PAEP)
1-CSB-MP017381HU	Cusabio	EUR 358.00 EUR 1257.00 EUR 514.00 EUR 927.00	100ug 1MG 200ug 500ug
MW: 23.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Glycodelin(PAEP) expressed in Mammalian cell

PAEP ELISA Kit (Human) : 96 Wells (OKEH02065)
OKEH02065	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL

Human Endometrial Adenocarcinoma CAFs
CAF01	Neuromics	1,000,000 cells	EUR 1223

PAEP Antibody
33016-100ul	SAB	100ul	EUR 252

PAEP Antibody
DF2701	Affbiotech	200ul	EUR 304
Description: PAEP antibody detects endogenous levels of total PAEP.

PAEP Antibody
1-CSB-PA017381LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

PAEP Antibody
1-CSB-PA043641	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300

PAEP Antibody
1-CSB-PA198597	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

PAEP siRNA
20-abx927607	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PAEP Antibody
ABD2701	Lifescience Market	100 ug	EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PAEP protein (His tag)
80R-2711	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant PAEP protein (His tag)

Human PAEP shRNA Plasmid
20-abx953353	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PAEP Rabbit pAb
A11810-100ul	Abclonal	100 ul	EUR 308

PAEP Rabbit pAb
A11810-200ul	Abclonal	200 ul	EUR 459

PAEP Rabbit pAb
A11810-20ul	Abclonal	20 ul	Ask for price

PAEP Rabbit pAb
A11810-50ul	Abclonal	50 ul	Ask for price

PAEP Rabbit pAb
A14757-100ul	Abclonal	100 ul	EUR 308

PAEP Rabbit pAb
A14757-200ul	Abclonal	200 ul	EUR 459

PAEP Rabbit pAb
A14757-20ul	Abclonal	20 ul	EUR 183

PAEP Rabbit pAb
A14757-50ul	Abclonal	50 ul	EUR 223

PAEP Blocking Peptide
DF2701-BP	Affbiotech	1mg	EUR 195

PAEP Conjugated Antibody
C33016	SAB	100ul	EUR 397

PAEP cloning plasmid
CSB-CL017381HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 543 Sequence: atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggt Show more
Description: A cloning plasmid for the PAEP gene.

PAEP Rabbit pAb
A5751-100ul	Abclonal	100 ul	EUR 308

PAEP Rabbit pAb
A5751-200ul	Abclonal	200 ul	EUR 459

PAEP Rabbit pAb
A5751-20ul	Abclonal	20 ul	EUR 183

PAEP Rabbit pAb
A5751-50ul	Abclonal	50 ul	EUR 223

PAEP Polyclonal Antibody
ABP59813-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PAEP protein Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody
ABP59813-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PAEP protein Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody
ABP59813-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PAEP protein Applications tips:
Description: A polyclonal antibody for detection of PAEP from Human. This PAEP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAEP protein

PAEP Polyclonal Antibody
ES10976-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAEP Polyclonal Antibody
ES10976-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PAEP from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PAEP antibody
STJ28318	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody
STJ113389	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody
STJ116957	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin, but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants.

Anti-PAEP antibody
STJ192134	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PAEP

PAEP ORF Vector (Human) (pORF)
ORF007480	ABM	1.0 ug DNA	EUR 95

PAEP Protein Vector (Human) (pPB-C-His)
PV029917	ABM	500 ng	EUR 329

PAEP Protein Vector (Human) (pPB-N-His)
PV029918	ABM	500 ng	EUR 329

PAEP Protein Vector (Human) (pPM-C-HA)
PV029919	ABM	500 ng	EUR 329

PAEP Protein Vector (Human) (pPM-C-His)
PV029920	ABM	500 ng	EUR 329

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Immortalized Human Endometrial Stromal Cells (HESC)
T0533	ABM	1x106 cells / 1.0 ml	EUR 1500

Immortalized Human Endometrial Stromal Cells-SV40
T9201	ABM	1x106 cells / 1.0 ml	EUR 1500

PAEP Antibody, HRP conjugated
1-CSB-PA017381LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PAEP Antibody, FITC conjugated
1-CSB-PA017381LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PAEP Antibody, Biotin conjugated
1-CSB-PA017381LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAEP. Recognizes PAEP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EM (Anti-endometrial Antibody IgG) ELISA test
56	Biobase	96T/Box	Ask for price
Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of EM (Anti-endometrial Antibody IgG)