Human SULF2(Sulfatase 2) ELISA Kit

Human SULF2(Sulfatase 2) ELISA Kit

To Order Contact us:

Human Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Hu-48Tests 48 Tests
EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Hu-96Tests 96 Tests
EUR 723

Human Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Hu-48Tests 48 Tests
EUR 544

Human Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Hu-96Tests 96 Tests
EUR 756

Mouse Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Mu-48T 48T
EUR 527
  • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

DLR-SULF2-Mu-96T 96T
EUR 688
  • Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Mu-48Tests 48 Tests
EUR 533

Mouse Sulfatase 2 (SULF2) ELISA Kit

RD-SULF2-Mu-96Tests 96 Tests
EUR 740

Mouse Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Mu-48Tests 48 Tests
EUR 557

Mouse Sulfatase 2 (SULF2) ELISA Kit

RDR-SULF2-Mu-96Tests 96 Tests
EUR 774

Human Sulfatase 2 (SULF2) ELISA Kit

abx573928-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sulfatase 2 (SULF2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2) ELISA Kit

abx253890-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Sulfatase 2 ELISA Kit (SULF2)

RK02346 96 Tests
EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

SEH107Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2
  • Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sulfatase 2 (SULF2) ELISA Kit

abx573406-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit

abx254754-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

SEH107Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2
  • Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human SULF2 (Sulfatase 2)

ELK3437 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Sulfatase 2 (SULF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody

abx145711-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody

abx027017-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody

abx027017-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sulfatase 2 (SULF2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody

abx433330-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Sulfatase 2 (SULF2) Antibody

abx238375-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sulfatase 2 (SULF2) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Sulfatase 2 (SULF2)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWU5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 65.7kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Sulfatase 2 expressed in: E.coli

Recombinant Sulfatase 2 (SULF2)

  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CFG0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.5kDa
  • Isoelectric Point: 8.9
Description: Recombinant Mouse Sulfatase 2 expressed in: E.coli

Human Sulfatase 2 (SULF2) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2)CLIA Kit

SCH107Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit

SCH107Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit

SCH107Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit

SCH107Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 2 Clia kit. Alternative names of the recognized antigen: HSULF-2
  • Extracellular sulfatase Sulf-2
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2)Serum, plasma, tissue homogenates and other biological fluids

Human Sulfatase 2 (SULF2) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse SULF2 (Sulfatase 2)

ELK7166 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human SULF2/ Extracellular sulfatase Sulf-2 ELISA Kit

E2423Hu 1 Kit
EUR 571

Human SULF2(Extracellular sulfatase Sulf-2) ELISA Kit

EH0934 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q8IWU5
  • Alias: SULF2/extracellular sulfatase Sulf-2/SULF-2/sulfatase 2/hSulf-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Sulfatase 2 (SULF2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Sulfatase 2 (SULF2) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Sulfatase 2 (SULF2) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Sulf2/ Extracellular sulfatase Sulf-2 ELISA Kit

E1426Mo 1 Kit
EUR 571

Mouse Sulf2(Extracellular sulfatase Sulf-2) ELISA Kit

EM0398 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8CFG0
  • Alias: Sulf2/SULF-2/sulfatase 2/Sulf-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)

KTE60401-48T 48T
EUR 332
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)

KTE60401-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)

KTE60401-96T 96T
EUR 539
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2)

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2)

Sulf2 ELISA Kit| Mouse Extracellular sulfatase Sulf-2 ELISA Kit

EF013058 96 Tests
EUR 689

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)

KTE70279-48T 48T
EUR 332
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)

KTE70279-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)

KTE70279-96T 96T
EUR 539
  • Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with APC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with Biotin.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with Cy3.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with FITC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with HRP.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with PE.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with APC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with Biotin.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with Cy3.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with FITC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with HRP.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with PE.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg649)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with APC-Cy7.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SULF2 (Phe337~Arg654)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with APC-Cy7.


ELA-E0511h 96 Tests
EUR 824


EF000643 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

SULF2 ELISA Kit (Human) (OKAN05695)

OKAN05695 96 Wells
EUR 792
Description: Description of target: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.121 ng/mL

SULF2 ELISA Kit (Human) (OKCD09025)

OKCD09025 96 Wells
EUR 975
Description: Description of target: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules.Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005.)...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

ELISA kit for Human Iduronate 2-sulfatase

EK1482 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Iduronate 2-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS/ Iduronate 2-sulfatase ELISA Kit

E1209Hu 1 Kit
EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit

EH0767 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P22304
  • Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit

abx253725-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-48T 48T
EUR 517
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

DLR-IDS-Hu-96T 96T
EUR 673
  • Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase ELISA Kit (IDS)

RK01625 96 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-48Tests 48 Tests
EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RD-IDS-Hu-96Tests 96 Tests
EUR 723

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-48Tests 48 Tests
EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

RDR-IDS-Hu-96Tests 96 Tests
EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

SEH833Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2
  • SIDS
  • Hunter Syndrome
  • Idursulfase
  • Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Iduronate sulfatase ELISA kit

E01I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit

E01I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit

E01I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase ELISA Kit

QY-E05306 96T
EUR 361

ELISA kit for Human IDS (Iduronate-2-Sulfatase)

ELK3439 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Iduronate-2-Sulfatase (IDS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Iduron
  • Show more
Description: A sandwich ELISA kit for detection of Iduronate-2-Sulfatase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Sulfatase- modifying factor 2, SUMF2 ELISA KIT

ELI-41752h 96 Tests
EUR 824

Human Sulfatase Modifying Factor 2 (SUMF2) ELISA Kit

abx383568-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SULF2 ELISA Kit (Mouse) (OKCD09026)

OKCD09026 96 Wells
EUR 1001
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin (By similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.7pg/mL

SULF2 ELISA Kit (Mouse) (OKEH04336)

OKEH04336 96 Wells
EUR 662
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin (By similarity).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Mouse Iduronate 2-Sulfatase (Ids) ELISA Kit

abx512185-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

SULF2 Chemi-Luminescent ELISA Kit (Human) (OKCD03932)

OKCD03932 96 Wells
EUR 988
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 ng/mL

SULF2 ELISA Kit (Human) : 96 Wells (OKEH00485)

OKEH00485 96 Wells
EUR 740
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.21 ng/mL

Human Iduronate-2-Sulfatase (IDS) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit

SCH833Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Iduronate-2-Sulfatase Clia kit. Alternative names of the recognized antigen: MPS2
  • SIDS
  • Hunter Syndrome
  • Idursulfase
  • Alpha-L-iduronate sulfate sulfatase
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS)Tissue homogenates and other biological fluids

Human Sulfatase 1 (SULF1) ELISA Kit

abx573979-96tests 96 tests
EUR 825
  • Shipped within 20 working days.

Human aryl sulfatase A ELISA kit

E01A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit

E01A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit

E01A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Steryl-sulfatase

EK4979 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Steryl-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STS/ Steryl-sulfatase ELISA Kit

E2419Hu 1 Kit
EUR 605

Human STS(Steryl-sulfatase) ELISA Kit

EH2478 96T
EUR 567.6
  • Detection range: 1.56-100 ng/ml
  • Uniprot ID: P08842
  • Alias: STS/Steryl-sulfate sulfohydrolase/Arylsulfatase C(ASC)/Steroid sulfatase/ARSC1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Steryl- sulfatase, STS ELISA KIT

ELI-52169h 96 Tests
EUR 824

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-48T 48T
EUR 289

Human iduronate sulfatase(IDS)ELISA Kit

GA-E0747HM-96T 96T
EUR 466

Human Sulfatase 1 (SULF1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Steryl-sulfatase (STS) ELISA Kit

abx251845-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human iduronate sulfatase,IDS ELISA Kit

201-12-0731 96 tests
EUR 440
  • This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

DLR-SULF1-Hu-48T 48T
EUR 517
  • Should the Human Sulfatase 1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

DLR-SULF1-Hu-96T 96T
EUR 673
  • Should the Human Sulfatase 1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human iduronate sulfatase, IDS ELISA Kit

CSB-E09471h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H1 96T
EUR 448

Human iduronate sulfatase,IDS ELISA Kit

CN-04541H2 48T
EUR 297

Human Sulfatase 1 (SULF1) ELISA Kit

RD-SULF1-Hu-48Tests 48 Tests
EUR 521

Human Sulfatase 1 (SULF1) ELISA Kit

RD-SULF1-Hu-96Tests 96 Tests
EUR 723

Human Sulfatase 1 (SULF1) ELISA Kit

RDR-SULF1-Hu-48Tests 48 Tests
EUR 544

Human Sulfatase 1 (SULF1) ELISA Kit

RDR-SULF1-Hu-96Tests 96 Tests
EUR 756

Human Sulfatase 1(SULF1)ELISA Kit

QY-E02238 96T
EUR 361

Human iduronate sulfatase(IDS)ELISA Kit

QY-E04351 96T
EUR 361

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

SEH108Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sulfatase 1 elisa. Alternative names of the recognized antigen: HSULF-1
  • Extracellular sulfatase Sulf-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 1 (SULF1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

SULF2 Antibody

43638-100ul 100ul
EUR 252

SULF2 antibody

70R-1881 100 ug
EUR 377
Description: Rabbit polyclonal SULF2 antibody raised against the C terminal of SULF2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SULF2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULF2. Recognizes SULF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Mouse Sulfatase- modifying factor 2, Sumf2 ELISA KIT

ELI-53384m 96 Tests
EUR 865

Bovine Sulfatase- modifying factor 2, SUMF2 ELISA KIT

ELI-29910b 96 Tests
EUR 928

Iduronate 2 sulfatase Antibody

abx234130-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-Sulfatase 2 (2H5)

YF-MA18904 100 ug
EUR 363
Description: Mouse monoclonal to Sulfatase 2

anti-Iduronate 2 sulfatase

YF-PA12536 50 ug
EUR 363
Description: Mouse polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase

YF-PA12537 100 ul
EUR 403
Description: Rabbit polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase

YF-PA12538 100 ug
EUR 403
Description: Rabbit polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase

YF-PA23951 50 ul
EUR 334
Description: Mouse polyclonal to Iduronate 2 sulfatase

SULF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2312103 1.0 ug DNA
EUR 154

Goat Iduronate sulfatase ELISA kit

E06I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit

E06I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit

E06I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit

E02I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit

E02I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit

E02I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit

E03I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit

E04I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit

E08I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit

E07I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit

E09I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SULF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Iduronate-2-Sulfatase (IDS) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit

E01G0081-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human SULF1 (Sulfatase 1)

ELK4163 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 1 (SULF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 1 (S
  • Show more
Description: A sandwich ELISA kit for detection of Sulfatase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human aryl sulfatase A(ASA)ELISA Kit

GA-E0744HM-48T 48T
EUR 289

Human aryl sulfatase A(ASA)ELISA Kit

GA-E0744HM-96T 96T
EUR 466

Human aryl sulfatase A,ASA ELISA Kit

201-12-0728 96 tests
EUR 440
  • This aryl sulfatase A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human aryl sulfatase A,ASA ELISA Kit

CN-04535H1 96T
EUR 439

Human aryl sulfatase A,ASA ELISA Kit

CN-04535H2 48T
EUR 290

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-48T 48T
EUR 332
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-5platesof96wells 5 plates of 96 wells
EUR 2115
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)

KTE60396-96T 96T
EUR 539
  • STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human aryl sulfatase A(ARSA)ELISA Kit

QY-E03645 96T
EUR 361

SULF2 Conjugated Antibody

C43638 100ul
EUR 397

anti- SULF2 antibody

FNab08375 100µg
EUR 548.75
  • Immunogen: sulfatase 2
  • Uniprot ID: Q8IWU5
  • Gene ID: 55959
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SULF2

SULF2 Rabbit pAb

A8803-100ul 100 ul
EUR 308

SULF2 Rabbit pAb

A8803-200ul 200 ul
EUR 459

SULF2 Rabbit pAb

A8803-20ul 20 ul
EUR 183

SULF2 Rabbit pAb

A8803-50ul 50 ul
EUR 223

SULF2 Blocking Peptide

33R-2218 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SULF2 antibody, catalog no. 70R-1881

SULF2 cloning plasmid

CSB-CL810283HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atgccaggcctcacgtgcttcacccacgacaaccagcactggcagacggcgcctttctggacactggggcctttctgtgcctgcaccagcgccaacaataacacgtactggtgcatgaggaccatcaatgagactcacaatttcctcttctgtgaatttgcaactggcttcctaga
  • Show more
Description: A cloning plasmid for the SULF2 gene.

SULF2 cloning plasmid

CSB-CL810283HU2-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2613
  • Show more
Description: A cloning plasmid for the SULF2 gene.

Anti-SULF2 antibody

PAab08375 100 ug
EUR 386

Anti-SULF2 antibody

STJ71815 100 µg
EUR 359

Anti-SULF2 antibody

STJ111423 100 µl
EUR 277

anti- Iduronate 2 sulfatase antibody

FNab04130 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: iduronate 2-sulfatase
  • Uniprot ID: P22304
  • Gene ID: 3423
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against Iduronate 2 sulfatase

Sulfatase Modifying Factor 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody

abx145606-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Iduronate 2-Sulfatase (IDS) Antibody

abx432837-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22304
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08890
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1LLW8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Iduronate-2-Sulfatase expressed in: E.coli

Anti-Iduronate 2 sulfatase (3B4)

YF-MA13647 200 ul
EUR 363
Description: Mouse monoclonal to Iduronate 2 sulfatase

Mouse Steryl-sulfatase (STS) ELISA Kit

abx521168-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Steryl-sulfatase (STS) ELISA Kit

abx521169-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Sulfatase 1 (SULF1) ELISA Kit

abx547930-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Rat Iduronate Sulfatase (IDS) ELISA Kit

abx570921-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit

E05I0334-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit

E06A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit

E02A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit

E03A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit

E03A0874-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit

E03A0874-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit

E04A0874-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.