Human SULF2(Sulfatase 2) ELISA Kit

Human SULF2(Sulfatase 2) ELISA Kit

To Order Contact us: Lara@lipidx.org

Human Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
DLR-SULF2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sulfatase 2 (SULF2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sulfatase 2 (SULF2) ELISA Kit
RD-SULF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sulfatase 2 (SULF2) ELISA Kit
RDR-SULF2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Sulfatase 2 (SULF2) ELISA Kit
abx573928-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Sulfatase 2 (SULF2) ELISA Kit
20-abx153189	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2) ELISA Kit
abx253890-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Sulfatase 2 ELISA Kit (SULF2)
RK02346	Abclonal	96 Tests	EUR 521

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
SEH107Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) ELISA Kit
4-SEH107Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2 Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sulfatase 2 (SULF2) ELISA Kit
abx573406-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit
20-abx154718	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit
abx254754-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
SEH107Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Sulfatase 2 (SULF2) ELISA Kit
4-SEH107Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 2 elisa. Alternative names of the recognized antigen: HSULF-2 Extracellular sulfatase Sulf-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sulfatase 2 (SULF2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human SULF2 (Sulfatase 2)
ELK3437	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Sulfatase 2 (SULF2) Antibody
20-abx124711	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody
20-abx129892	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody
abx145711-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody
20-abx101038	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody
abx027017-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody
abx027017-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody
20-abx174656	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sulfatase 2 (SULF2) Antibody
20-abx318791	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody
abx433330-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Sulfatase 2 (SULF2) Antibody
abx238375-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sulfatase 2 (SULF2) Antibody
20-abx178499	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Recombinant Sulfatase 2 (SULF2)
4-RPH107Hu01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IWU5 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 65.7kDa Isoelectric Point: 8.7
Description: Recombinant Human Sulfatase 2 expressed in: E.coli

Recombinant Sulfatase 2 (SULF2)
4-RPH107Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8CFG0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 39.5kDa Isoelectric Point: 8.9
Description: Recombinant Mouse Sulfatase 2 expressed in: E.coli

Human Sulfatase 2 (SULF2) CLIA Kit
20-abx190328	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sulfatase 2 (SULF2)CLIA Kit
SCH107Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit
SCH107Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit
SCH107Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2)CLIA Kit
SCH107Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 2 (SULF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 2 (SULF2) CLIA Kit
4-SCH107Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 2 Clia kit. Alternative names of the recognized antigen: HSULF-2 Extracellular sulfatase Sulf-2
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Sulfatase 2 (SULF2)Serum, plasma, tissue homogenates and other biological fluids

Human Sulfatase 2 (SULF2) Protein
20-abx069185	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse SULF2 (Sulfatase 2)
ELK7166	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 2 (SULF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 2 (S Show more
Description: A sandwich ELISA kit for detection of Sulfatase 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human SULF2/ Extracellular sulfatase Sulf-2 ELISA Kit
E2423Hu	Sunlong	1 Kit	EUR 571

Human SULF2(Extracellular sulfatase Sulf-2) ELISA Kit
EH0934	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q8IWU5 Alias: SULF2/extracellular sulfatase Sulf-2/SULF-2/sulfatase 2/hSulf-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Sulfatase 2 (SULF2) CLIA Kit
20-abx495374	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Sulfatase 2 (SULF2) Protein
20-abx168370	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sulfatase 2 (SULF2) Antibody (HRP)
20-abx316365	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (FITC)
20-abx316366	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (Biotin)
20-abx316367	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfatase 2 (SULF2) Antibody (FITC)
20-abx271149	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Sulfatase 2 (SULF2) Antibody (Biotin)
20-abx271415	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Sulf2/ Extracellular sulfatase Sulf-2 ELISA Kit
E1426Mo	Sunlong	1 Kit	EUR 571

Mouse Sulf2(Extracellular sulfatase Sulf-2) ELISA Kit
EM0398	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q8CFG0 Alias: Sulf2/SULF-2/sulfatase 2/Sulf-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)
KTE60401-48T	Abbkine	48T	EUR 332
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)
KTE60401-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular sulfatase Sulf-2 (SULF2)
KTE60401-96T	Abbkine	96T	EUR 539
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse)
4-PAH107Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2)

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig)
4-PAH107Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2)

Sulf2 ELISA Kit| Mouse Extracellular sulfatase Sulf-2 ELISA Kit
EF013058	Lifescience Market	96 Tests	EUR 689

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)
KTE70279-48T	Abbkine	48T	EUR 332
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)
KTE70279-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Extracellular sulfatase Sulf-2 (SULF2)
KTE70279-96T	Abbkine	96T	EUR 539
Sulfatase 2contains an N-terminal signal sequence, followed by a sulfatase domain, a hydrophilic region, and a C-terminal substrate recognition domain.SULF2 shares about 64% identity with SULF1 and 94% identity with mouse Sulf2. PCR detected SULF2 ex Show more
Description: Quantitative sandwich ELISA for measuring Mouse Extracellular sulfatase Sulf-2 (SULF2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), APC
4-PAH107Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with APC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAH107Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with Biotin.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), Cy3
4-PAH107Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with Cy3.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), FITC
4-PAH107Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with FITC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), HRP
4-PAH107Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with HRP.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), PE
4-PAH107Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with PE.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), APC
4-PAH107Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with APC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), Biotinylated
4-PAH107Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with Biotin.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), Cy3
4-PAH107Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with Cy3.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), FITC
4-PAH107Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with FITC.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), HRP
4-PAH107Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with HRP.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), PE
4-PAH107Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with PE.

Sulfatase 2 (SULF2) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAH107Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg649) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Sulfatase 2 (SULF2). This antibody is labeled with APC-Cy7.

Sulfatase 2 (SULF2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH107Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SULF2 (Phe337~Arg654) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sulfatase 2 (SULF2). This antibody is labeled with APC-Cy7.

Human SULF2 ELISA Kit
ELA-E0511h	Lifescience Market	96 Tests	EUR 824

SULF2 ELISA KIT|Human
EF000643	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SULF2 ELISA Kit (Human) (OKAN05695)
OKAN05695	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.121 ng/mL

SULF2 ELISA Kit (Human) (OKCD09025)
OKCD09025	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules.Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005.)...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

ELISA kit for Human Iduronate 2-sulfatase
EK1482	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Iduronate 2-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IDS/ Iduronate 2-sulfatase ELISA Kit
E1209Hu	Sunlong	1 Kit	EUR 571

Human IDS(Iduronate 2-sulfatase) ELISA Kit
EH0767	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P22304 Alias: IDS/SIDS/MPS2/S/Alpha-L-iduronate sulfate sulfatase/iduronate 2-sulfatase/iduronate 2-sulfatase 14 kDa chain/iduronate 2-sulfatase 42 kDa chain/idursulfase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
20-abx151901	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Iduronate 2-Sulfatase (IDS) ELISA Kit
abx253725-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-48T	DL Develop	48T	EUR 517
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
DLR-IDS-Hu-96T	DL Develop	96T	EUR 673
Should the Human Iduronate-2-Sulfatase (IDS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Iduronate-2-Sulfatase ELISA Kit (IDS)
RK01625	Abclonal	96 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RD-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
RDR-IDS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
SEH833Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Iduronate-2-Sulfatase (IDS) in serum, plasma, tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) ELISA Kit
4-SEH833Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Iduronate-2-Sulfatase elisa. Alternative names of the recognized antigen: MPS2 SIDS Hunter Syndrome Idursulfase Alpha-L-iduronate sulfate sulfatase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Iduronate-2-Sulfatase (IDS) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Iduronate sulfatase ELISA kit
E01I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit
E01I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Iduronate sulfatase ELISA kit
E01I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase ELISA Kit
QY-E05306	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human IDS (Iduronate-2-Sulfatase)
ELK3439	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Iduronate-2-Sulfatase (IDS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Iduron Show more
Description: A sandwich ELISA kit for detection of Iduronate-2-Sulfatase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Sulfatase- modifying factor 2, SUMF2 ELISA KIT
ELI-41752h	Lifescience Market	96 Tests	EUR 824

Human Sulfatase Modifying Factor 2 (SUMF2) ELISA Kit
abx383568-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SULF2 ELISA Kit (Mouse) (OKCD09026)
OKCD09026	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin (By similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.7pg/mL

SULF2 ELISA Kit (Mouse) (OKEH04336)
OKEH04336	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin (By similarity).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Mouse Iduronate 2-Sulfatase (Ids) ELISA Kit
abx512185-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

SULF2 Chemi-Luminescent ELISA Kit (Human) (OKCD03932)
OKCD03932	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56 ng/mL

SULF2 ELISA Kit (Human) : 96 Wells (OKEH00485)
OKEH00485	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. It can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.21 ng/mL

Human Iduronate-2-Sulfatase (IDS) CLIA Kit
20-abx190349	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS)CLIA Kit
SCH833Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Iduronate-2-Sulfatase (IDS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS) in Tissue homogenates and other biological fluids.

Human Iduronate-2-Sulfatase (IDS) CLIA Kit
4-SCH833Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Iduronate-2-Sulfatase Clia kit. Alternative names of the recognized antigen: MPS2 SIDS Hunter Syndrome Idursulfase Alpha-L-iduronate sulfate sulfatase
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Iduronate-2-Sulfatase (IDS)Tissue homogenates and other biological fluids

Human Sulfatase 1 (SULF1) ELISA Kit
abx573979-96tests	Abbexa	96 tests	EUR 825
Shipped within 20 working days.

Human aryl sulfatase A ELISA kit
E01A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit
E01A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human aryl sulfatase A ELISA kit
E01A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Steryl-sulfatase
EK4979	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Steryl-sulfatase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STS/ Steryl-sulfatase ELISA Kit
E2419Hu	Sunlong	1 Kit	EUR 605

Human STS(Steryl-sulfatase) ELISA Kit
EH2478	FN Test	96T	EUR 567.6
Detection range: 1.56-100 ng/ml Uniprot ID: P08842 Alias: STS/Steryl-sulfate sulfohydrolase/Arylsulfatase C(ASC)/Steroid sulfatase/ARSC1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Steryl- sulfatase, STS ELISA KIT
ELI-52169h	Lifescience Market	96 Tests	EUR 824

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-48T	GenAsia Biotech	48T	EUR 289

Human iduronate sulfatase(IDS)ELISA Kit
GA-E0747HM-96T	GenAsia Biotech	96T	EUR 466

Human Sulfatase 1 (SULF1) ELISA Kit
20-abx153188	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Steryl-sulfatase (STS) ELISA Kit
abx251845-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human iduronate sulfatase,IDS ELISA Kit
201-12-0731	SunredBio	96 tests	EUR 440
This iduronate sulfatase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
DLR-SULF1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sulfatase 1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
DLR-SULF1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sulfatase 1 (SULF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase 1 (SULF1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human iduronate sulfatase, IDS ELISA Kit
CSB-E09471h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human iduronate sulfatase, IDS ELISA Kit
1-CSB-E09471h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human iduronate sulfatase, IDS in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H1	ChemNorm	96T	EUR 448

Human iduronate sulfatase,IDS ELISA Kit
CN-04541H2	ChemNorm	48T	EUR 297

Human Sulfatase 1 (SULF1) ELISA Kit
RD-SULF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sulfatase 1 (SULF1) ELISA Kit
RD-SULF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sulfatase 1 (SULF1) ELISA Kit
RDR-SULF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sulfatase 1 (SULF1) ELISA Kit
RDR-SULF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Sulfatase 1(SULF1)ELISA Kit
QY-E02238	Qayee Biotechnology	96T	EUR 361

Human iduronate sulfatase(IDS)ELISA Kit
QY-E04351	Qayee Biotechnology	96T	EUR 361

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
SEH108Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sulfatase 1 (SULF1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sulfatase 1 (SULF1) in serum, plasma, tissue homogenates and other biological fluids.

Human Sulfatase 1 (SULF1) ELISA Kit
4-SEH108Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sulfatase 1 elisa. Alternative names of the recognized antigen: HSULF-1 Extracellular sulfatase Sulf-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sulfatase 1 (SULF1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

SULF2 Antibody
43638-100ul	SAB	100ul	EUR 252

SULF2 antibody
70R-1881	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SULF2 antibody raised against the C terminal of SULF2

SULF2 siRNA
20-abx935634	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SULF2 siRNA
20-abx935635	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SULF2 Antibody
1-CSB-PA810283LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULF2. Recognizes SULF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Mouse Sulfatase- modifying factor 2, Sumf2 ELISA KIT
ELI-53384m	Lifescience Market	96 Tests	EUR 865

Bovine Sulfatase- modifying factor 2, SUMF2 ELISA KIT
ELI-29910b	Lifescience Market	96 Tests	EUR 928

Iduronate 2 sulfatase Antibody
abx234130-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Anti-Sulfatase 2 (2H5)
YF-MA18904	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Sulfatase 2

anti-Iduronate 2 sulfatase
YF-PA12536	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase
YF-PA12537	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase
YF-PA12538	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Iduronate 2 sulfatase

anti-Iduronate 2 sulfatase
YF-PA23951	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Iduronate 2 sulfatase

SULF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2312103	ABM	1.0 ug DNA	EUR 154

Goat Iduronate sulfatase ELISA kit
E06I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit
E06I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Iduronate sulfatase ELISA kit
E06I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit
E02I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit
E02I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Iduronate sulfatase ELISA kit
E02I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Iduronate sulfatase ELISA kit
E03I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Iduronate sulfatase ELISA kit
E04I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Iduronate sulfatase ELISA kit
E08I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Iduronate sulfatase ELISA kit
E07I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Iduronate sulfatase ELISA kit
E09I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SULF2 shRNA Plasmid
20-abx961022	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Iduronate-2-Sulfatase (IDS) Protein
20-abx067169	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N Acetylgalactosamine 6 Sulfatase ELISA kit
E01G0081-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N Acetylgalactosamine 6 Sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human SULF1 (Sulfatase 1)
ELK4163	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sulfatase 1 (SULF1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sulfatase 1 (S Show more
Description: A sandwich ELISA kit for detection of Sulfatase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human aryl sulfatase A(ASA)ELISA Kit
GA-E0744HM-48T	GenAsia Biotech	48T	EUR 289

Human aryl sulfatase A(ASA)ELISA Kit
GA-E0744HM-96T	GenAsia Biotech	96T	EUR 466

Human aryl sulfatase A,ASA ELISA Kit
201-12-0728	SunredBio	96 tests	EUR 440
This aryl sulfatase A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human aryl sulfatase A,ASA ELISA Kit
CN-04535H1	ChemNorm	96T	EUR 439

Human aryl sulfatase A,ASA ELISA Kit
CN-04535H2	ChemNorm	48T	EUR 290

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-48T	Abbkine	48T	EUR 332
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Steryl-sulfatase (STS)
KTE60396-96T	Abbkine	96T	EUR 539
STS catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. The deduced 583-residue protein has a molecular mass of 63 kD and cont Show more
Description: Quantitative sandwich ELISA for measuring Human Steryl-sulfatase (STS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human aryl sulfatase A(ARSA)ELISA Kit
QY-E03645	Qayee Biotechnology	96T	EUR 361

SULF2 Conjugated Antibody
C43638	SAB	100ul	EUR 397

anti- SULF2 antibody
FNab08375	FN Test	100µg	EUR 548.75
Immunogen: sulfatase 2 Uniprot ID: Q8IWU5 Gene ID: 55959 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SULF2

SULF2 Rabbit pAb
A8803-100ul	Abclonal	100 ul	EUR 308

SULF2 Rabbit pAb
A8803-200ul	Abclonal	200 ul	EUR 459

SULF2 Rabbit pAb
A8803-20ul	Abclonal	20 ul	EUR 183

SULF2 Rabbit pAb
A8803-50ul	Abclonal	50 ul	EUR 223

SULF2 Blocking Peptide
33R-2218	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SULF2 antibody, catalog no. 70R-1881

SULF2 cloning plasmid
CSB-CL810283HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 450 Sequence: atgccaggcctcacgtgcttcacccacgacaaccagcactggcagacggcgcctttctggacactggggcctttctgtgcctgcaccagcgccaacaataacacgtactggtgcatgaggaccatcaatgagactcacaatttcctcttctgtgaatttgcaactggcttcctaga Show more
Description: A cloning plasmid for the SULF2 gene.

SULF2 cloning plasmid
CSB-CL810283HU2-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2613 Sequence: ATGGGCCCCCCGAGCCTCGTGCTGTGCTTGCTGTCCGCAACTGTGTTCTCCCTGCTGGGTGGAAGCTCGGCCTTCCTGTCGCACCACCGCCTGAAAGGCAGGTTTCAGAGGGACCGCAGGAACATCCGCCCCAACATCATCCTGGTGCTGACGGACGACCAGGATGTGGAGCTGG Show more
Description: A cloning plasmid for the SULF2 gene.

Anti-SULF2 antibody
PAab08375	Lifescience Market	100 ug	EUR 386

Anti-SULF2 antibody
STJ71815	St John's Laboratory	100 µg	EUR 359

Anti-SULF2 antibody
STJ111423	St John's Laboratory	100 µl	EUR 277

anti- Iduronate 2 sulfatase antibody
FNab04130	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: iduronate 2-sulfatase Uniprot ID: P22304 Gene ID: 3423 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against Iduronate 2 sulfatase

Sulfatase Modifying Factor 2 Antibody
20-abx115886	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx130132	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody
abx145606-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx102026	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx102027	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Iduronate 2-Sulfatase (IDS) Antibody
20-abx006700	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Iduronate-2-Sulfatase (IDS) Antibody
20-abx172861	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Iduronate 2-Sulfatase (IDS) Antibody
abx432837-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P22304 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Mu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q08890 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Iduronate-2-Sulfatase expressed in: E.coli

Recombinant Iduronate-2-Sulfatase (IDS)
4-RPH833Ra01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F1LLW8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 59.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Iduronate-2-Sulfatase expressed in: E.coli

Anti-Iduronate 2 sulfatase (3B4)
YF-MA13647	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Iduronate 2 sulfatase

Mouse Steryl-sulfatase (STS) ELISA Kit
abx521168-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Steryl-sulfatase (STS) ELISA Kit
abx521169-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Sulfatase 1 (SULF1) ELISA Kit
abx547930-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-2 months.

Rat Iduronate Sulfatase (IDS) ELISA Kit
abx570921-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Iduronate sulfatase ELISA kit
E05I0334-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Iduronate sulfatase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat aryl sulfatase A ELISA kit
E06A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat aryl sulfatase A ELISA kit
E02A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit
E03A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit
E03A0874-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse aryl sulfatase A ELISA kit
E03A0874-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit aryl sulfatase A ELISA kit
E04A0874-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit aryl sulfatase A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.